|
|
||||||||
|
A Two-Component Enhancer-Inhibitor Transposon Mutagenesis System for Functional Analysis of the Arabidopsis GenomeElly Speulmana, Peter L. J. Metza, Gert van Arkela, Bas te Lintel Hekkerta, Willem J. Stiekemaa, and Andy Pereiraaa Centre for Plant Breeding and Reproduction Research, Department of Molecular Biology, P.O. Box 16, NL-6700 AA Wageningen, The Netherlands Correspondence to: Andy Pereira, A.Pereira{at}cpro.dlo.nl (E-mail), 31-317-418094 (fax)
A modified Enhancer-Inhibitor transposon system was used to generate a series of mutant lines by single-seed descent such that multiple I insertions occurred per plant. The distribution of original insertions in the population was assessed by isolating transposon-flanking DNA, and a database of insertion sites was created. Approximately three-quarters of the identified insertion sites show similarity to sequences stored in public databases, which demonstrates the power of this regimen of insertional mutagenesis. To isolate insertions in specific genes, we developed three-dimensional pooling and polymerase chain reaction strategies that we then validated by identifying mutants for the regulator genes APETALA1 and SHOOT MERISTEMLESS. The system then was used to identify inserts in a class of uncharacterized genes involved in lipid biosynthesis; one such insertion conferred a fiddlehead mutant phenotype.
Over the past two decades, Arabidopsis has become a model organism for research in plant physiology, development, biochemistry, and pathogenesis. Recent developments in Arabidopsis genomics research include the construction of a nearly complete physical map of the genome based on yeast artificial chromosomes (
The large amount of sequence information generated by Arabidopsis genome and EST sequencing projects will provide the basis for systematic studies of gene function and eventually will allow for unlimited comparisons with the yeast (
Over the past decade, insertional mutagenesis has proven to be one of the most efficient ways of isolating and identifying genes via the traditional approaches of "forward" genetics (
In one well-described reverse genetics strategy, the identification of gene-specific insertions from among a large mutagenized population involves polymerase chain reactions (PCRs) in which the first primer is designed to anneal to the insertion sequence and the second anneals to the targeted gene. Thus, PCR products are specified by a combination of the target gene and the insertion element, thereby indicating the proximity of insertion to the gene of interest. Specific pooling strategies then can lead to identification of the desired mutant individual or individuals within the treated population. This target-selected mutational strategy has been applied successfully within studies of Drosophila, Caenorhabditis, maize, and petunia (
In Arabidopsis, most reverse genetics screens have used T-DNA insertional mutagenesis (
Our two-component system consists of a mobile I transposon and an immobilized trans-active En transposase under control of the cauliflower mosaic virus 35S promoter. A stable transposase locus, T-En5, was shown to mediate frequent transposition of I elements throughout plant development (
To demonstrate the use of this population in reverse genetics approaches, we use the well-studied developmental regulator genes APETALA1 (AP1;
An ITS Database from the Multiple-Transposon Population
To assess and predict the distribution of inserts in the population, we chose a set of 17 S1 lines (see Figure 1) that were T-En5 transposase free and thus represented the base population of independent inserts within the seven original lines. Inverse PCR products were isolated from these 17 lines, cloned, and sequenced. An initial database of ~250 primary sequences was generated, after vector and transposon end removal. Table 1 displays a summary of the unique sequences (ITS 1 to 99) from these lines after analysis and database searches. We identified between 10 and 18 I element inserts per plant, but this range probably underestimates the actual number because not all inserts are equally accessible by the inverse PCR technique with the one enzyme (HinfI) used. The transposase-free plants were selected by segregation of the transposase, and in this process, one-fourth of the inserts that are linked or randomly segregated were lost. We estimate, based on these extrapolations and genomic DNA gel blots, that the plants at the onset of population development contained ~20 to 25 I elements per plant.
The ITS database was filtered for poor and redundant sequences, yielding a total of 99 nonredundant ITSs in the 17 S1 plants. The overall efficiency for recovery was 40%. Sequences were given an ITS identity number for entry in public databases. To generate a population of stable transposons from the advanced S6 generation of plants containing multiple independent transposons, we outcrossed a set of plants to the wild-type Landsberg erecta (Ler) ecotype to segregate the T-En5 transposase source. We established a simple hygromycin-sensitive screening procedure (see Methods) supplemented by a PCR screen to select T-En5 transposase-free (F2) segregants from the S6 generation. Approximately 50% of the hygromycin-sensitive seedlings turned out to be free of T-En5 by the PCR test, the escapes probably due to a weak and nonuniform resistance reaction. In setting up the procedure for establishing the stable transposon population, seven plants were used for isolation and sequencing of ~25 different inverse PCR products. On this limited scale, 18 new ITSs (designated ITS 100 to 117) were obtained. Perhaps the most remarkable observation of the ITS database comes from the compilation of target site duplications (TSDs). Specifically, there is a striking prevalence of A+T (73%) nucleotides and a complete absence of trinucleotide sequences consisting solely of G+C. This sample thus suggests a bias in insertional specificity toward A-Trich sites in the genome. The ITS sequences were compared with those of the public databases by using the BLAST suite and the nonredundant nucleotide, protein, or EST databases. The sequences with a significant BLAST score are indicated in Table 1. Remarkably, 87 of the presented 117 ITSs (74%) show significant similarity to some sequence in the databases. This high frequency sequence similarity is due to the extensive sequence information (average 320 bp) available from the clones derived by inverse PCR. Figure 2 displays the positions of the I elements that were scattered over the sequenced portions of the chromosomes, except for chromosome III, for which little sequence information is available. The number of ITSs that could be chromosome-positioned (76, i.e. 65%) correlates to the extent that chromosomal sequences are defined in the databases. This correlation thus demonstrates the power of the sequence-based system described here for mapping and validates the approach as a method for identifying insertions in those genes annotated in the database entries. The concentration of insertions (15 of the chromosome-positioned 76) at the bottom half of chromosome II, the original source of the I elements, suggests local transposition from the T-DNA (T-En5). Indeed, ~10% of all transpositions occurred near the original T-DNA insert. Surprisingly, very few insertions are mapped to the end of chromosome II that is distal to the T-En5 locus. This absence probably reflects a bias in transposition or the direction of recombination events in generation of the transposase-free lines. An encouraging feature is that genes even very closely situated to T-En5, such as the LTP gene or the Mlo-hi gene, situated ~5 centimorgans (cM) away, can be tagged and recovered in a T-En5free line, presumably after recombinational segregation.
Significantly, known or predicted genes could be exactly positioned by our approach. Among the gene families for which our approach proved effective were those encoding MYB-like proteins, homeodomain proteins, cytochrome P450-like proteins, AP2-domain containing proteins, actin, invertase, sucrose transporters, MLO-like proteins, 2S1 albumin, metalloproteinase, ACC oxidase, and transferases. These results demonstrate that such an ITS database, generated from transposase-free plants, can be directly used for mutational analyses.
Three-Dimensional Pooling and PCR Strategies
To standardize parameters for screening the population and to test the screening strategy for its use in reverse genetics, we used the genes AP1 and STM, with well-characterized mutant phenotypes, to identify ap1::I and stm::I insertion alleles. Phenotypes, possibly related to insertions in AP1 and STM, had been observed in the population at addresses V-11-G and XII-5-B, respectively. It therefore was expected, provided that these phenotypes were caused by I element insertions, that the three-dimensional pooling and PCR strategies would successfully identify the mutant plants.
Identification and Analysis of an stm::I Mutant Allele
Identification and Analysis of ap1::I Mutant Alleles
The insertion sites in the AP1 alleles (Figure 6B) were characterized by cloning and sequencing of PCR products, revealing that the insertion in ap1::I(V-11-G) was present in the seventh exon, seven nucleotides from the exon/intron boundary of exon 7 and intron 6, whereas the insertion in allele ap1::I(V-11-G) was present in the first intron, 17 nucleotides from the second exon. The ap1::I(XIX-6-E) allele, containing the I element in the intron, displayed a mutant phenotype. The I insert is oriented (considering coordinates of the En/Spm element transcription) in the same direction as that of the AP1 gene transcription. To test if the mutant phenotype were transposase dependent (suppressor function;
Reverse Genetics of FAE1 Homologs
Genomic DNA gel blot analysis (Figure 7B) of the fdh mutant progeny (lanes 6 to 11) revealed a 5.5-kb insertion allele; a band representing the 3.3-kb excision allele also was visible at a scanned density that was 30% of that of the 5.5-kb band (see Methods). A plant showing a revertant phenotype (lane 12) displayed a majority (65%) of the 3.3-kb wild-type allele. On average, ~10% germinal revertants were obtained that had lost a fdh::I allele. In the phenotypically wild-type progeny (lanes 1 to 5) of a revertant, a majority in the wild-type 3.3-kb fragment (65% in lanes 1, 4, and 5) is evident. This band shift in revertant progeny, along with the other DNA gel blot data, confirms the correlation between the fdh mutant phenotype and the presence of the insert in the FAE1 homolog. Recently, the complete sequence of the FDH gene (GenBank accession number
AJ010713) was deposited in the database and offers corroboratory evidence that our insertional mutant indeed occurs in the FDH gene (
Insertional mutagenesis has proven to be a powerful tool for generating knockout mutations in Arabidopsis. Such mutations often give rise to phenotypes that provide clues to the function of the gene in the organism. With the advent of large-scale genome sequencing, the number of putative genes has increased greatly, and there is now a prevalent interest to verify their functions. In a systematic gene function search strategy, insertional mutants that display a phenotype give a straightforward way to describe the potential function of a gene.
In endogenous transposon systems, such as those that exist in Drosophila, petunia, and maize, multiple transposons are present per individual, and so genome saturation with insertions can be attained with a relatively small number of individuals. In contrast, heterologous T-DNA or transposon insertions into Arabidopsis usually must begin with a few transformed copies per individual. The En-I transposon system nevertheless has proven capable of accumulating in copy number in Arabidopsis by virtue of its high independent transposition frequency (
To assess the randomness of the I element distribution in the Arabidopsis population that we generated, we compiled an ITS database of the original 17 S1 lines. A total of 99 independent insertions were identified in transposase-free S1 segregants from which our population descended, originating from seven transposon-bearing lines, each of which was estimated to contain seven to 10 inserts. Thus, in three generations of crossing and selfing, the original 49 to 70 inserts had accumulated to 99 independent inserts, which translates into an overall transposition frequency of 40 to 100% (or between 13 and 33% per generation), in good agreement with previous observations (
An apparent preference for insertion into A-Trich regions also was observed. Specifically, 73% of the nucleotides that comprise the compiled TSDs were either A or T, and not a single one of the 117 ITSs created a TSD consisting solely of G and C nucleotides. Interestingly, analysis of a 1.9-Mb sequence of the Arabidopsis genome showed that the A+T content of introns and intergenic regions is 66 to 67%, whereas that of exons is 56% ( Our ITS database was compared with public databases, and many ITSs were found to correspond to deposited gene sequences (see Table 1). Many of these genes already have been found to be essential to Arabidopsis, and so insertion alleles, such as those apparently generated in our present work, deserve further study. An especially intriguing dimension to mutant analysis that is engendered by the insertional mutants created here is the possibility for revertant analysis potentially made possible by use of transposase-containing lines. It is in any event clear that the generation of an ITS database, such as that compiled here, represents a powerful novel method to create inserts in a variety of genes so that their essentiality and function may be assessed.
To demonstrate the applicability of our mutagenic regime to specific genes of interest, we searched for the ap1::I and stm::I mutations in our population. The three-dimensional pooling strategy that we used to find these mutations within our population of 2592 multiple-transposon lines was described and successfully used previously for petunia (
We also recovered a mutant that bears an insertion in an FAE1 homolog and displays a fdh phenotype, thereby demonstrating a role for long-chain lipid synthesis in epidermis development. This finding directly exemplifies the use of our system for identifying inserts in members of multigene families. Interestingly, an FAE1 homolog recently has been ascribed a function in cuticular wax biosynthesis by sense suppressionmediated reverse genetics ( Part of our rationale in choosing to generate a population of lines containing multiple I elements per plant was to decrease the number of lines necessary for PCR analysis relative to mutagenic regimes that depend on T-DNA. Implementation of this choice clearly did not interfere in the identification of mutations carrying an insertion in a gene of interest. While our population was being generated over several generations, PCR screens were performed with ~150 genes by collaborators (data not shown). Insertions were found for ~100 genes and shown to be heritable in 50% of the initial positives. These insertions currently are being used in functional analyses in several laboratories worldwide. It also should be noted that our multiple-transposon population, manifesting a number of phenotypes among the 2592 lines, also can be subjected to traditional forward genetic screens. Definite proof for a correlation between a particular phenotype and an insertion in a given gene can be obtained by cosegregation analysis in transposase-free plants, the identification of revertant sectors, and independent insertion alleles with similar phenotypes. These procedures help distinguish insertionally tagged mutants from the background of "footprint" mutants that inevitably arise in transposon-mediated mutagenesis.
In conclusion, our population of multiple-transposon Arabidopsis lines can be used to identify insertions in any gene or DNA sequence and is a valuable addition to the available collection of T-DNA insertions (
Generation of Lines Containing Multiple I Elements
Isolation of Genomic DNA
Generation of Inhibitor-Tagged Sites
Development of Stable I-Containing Lines
Detection and Analysis of I Insertions To screen for insertions in genes homologous to FAE1, we requested a number of expressed sequence tag (EST) clones with homologies to FAE1 from the Arabidopsis Biological Resource Center (Ohio State University, Columbus) and completely sequenced them. Five FAE1 homologous clones (ATTS1282, ATTS3218, ATTS3252, G7F6T7, and G11D6T7) were chosen for further analysis; primers complementary to their 3' ends were synthesized and used for reverse genetics PCR screens. The primer complementary to the EST sequence ATTS 3252, termed e3252: CCTGGTTGGCTTCTTCACCTTCCTC, was used in further analysis described here. PCRs were performed in a total volume of 50 µL (0.5 µg of each primer, 250 µM of each nucleotide, and 1 x Supertaq buffer), containing 50 to 100 ng of DNA and 1 unit of Taq DNA polymerase (Supertaq; HT Biotechnology Ltd.). The reactions were performed in a PTC-200 Peltier Thermal Cycler (MJ Research): one incubation at 94°C for 4 min, followed by 31 cycles of 45 sec at 94°C, 45 sec at 60°C, 3 min at 72°C, followed by a 7-min extension step at 72°C. Amplification products were size separated on 1% TBE (45 mM Tris-borate and 1 mM EDTA) agarose gels containing ethidium bromide, alkali treated, then vacuum transferred onto Hybond-N+ membranes and hybridized to a gene-specific probe. Primer combinations 1074 and 1075 for STM and 1078 and 1079 for AP1 (Figure 5) were used to amplify genomic DNA products for use as probes. For the FAE1 homolog gene screens, the cDNA fragments from the EST clones were used as probes. After identification of a positive three-dimensional insertion address, ~30 seeds of the positive plant were grown in vitro on 0.5 x Murashige and Skoog medium (Duchefa, Haarlem, The Netherlands) and harvested as a pool in an Eppendorf tube when the primary leaves of the seedlings started to appear. After reconfirmation of an insertion after DNA extraction, PCR, and DNA gel blotting and hybridization, 12 to 24 seeds were sown again as individuals in the greenhouse. Amplification products from pooled DNA as well as from DNA of individual plants, obtained with each gene-specific primer and both I primers, were cloned into the PGEM-T vector (Promega) and sequenced. Individuals were screened for visible phenotypes, and floral material was harvested for DNA extractions. The individual plants were analyzed further for insertion sites by using PCRs as described above and genomic DNA gel blot analysis.
DNA Gel Blot Analysis
We thank Raffaella Greco, Hailing Jin, Marten Denekamp, Dr. John Ward, Sonja Gazzarini, Dr. Anja Schneider, and Andreas Möller for their help in harvesting and DNA extractions of several populations. We also thank Dr. Mark Aarts for selecting the initial transposon lines, Marjo van Staveren for technical assistance, and Dr. Marty Yanofsky for providing the genomic sequence of AP1. The Arabidopsis Biological Resource Center is gratefully acknowledged for the EST clones, and the European Union Biotech Project AIM (Grant No. BIO4-CT95-0183) is thanked for financial support. Received July 14, 1999; accepted August 24, 1999.
Aarts, M.G.M., Dirkse, W.G., Stiekema, W.J., and Pereira, A. (1993) Transposon tagging of a male sterility gene in Arabidopsis.. Nature 363:715-717[CrossRef][Medline]. Aarts, M.G.M., Corzaan, P., Stiekema, W.J., and Pereira, A. (1995a) A two-element Enhancer-Inhibitor transposon system in Arabidopsis thaliana.. Mol. Gen. Genet. 247:555-564[CrossRef][Medline]. Aarts, M.G.M., Keijzer, C.J., Stiekema, W.J., and Pereira, A. (1995b) Molecular characterization of the CER1 gene of Arabidopsis involved in epicuticular wax biosynthesis and pollen fertility. Plant Cell 7:2115-2127[Abstract]. Azpiroz-Leehan, R., and Feldmann, K.A. (1997) T-DNA insertion mutagenesis in Arabidopsis: Going back and forth. Trends Genet. 13:152-156[CrossRef][Web of Science][Medline].
Ballinger, D.G., and Benzer, S. (1989) Targeted gene mutations in Drosophila.. Proc. Natl. Acad. Sci. USA 86:9402-9406 Bancroft, I., and Dean, C. (1993) Transposition pattern of the maize element Ds in Arabidopsis thaliana.. Genetics 134:1221-1229[Abstract].
Bancroft, I., Jones, J.D.G., and Dean, C. (1993) Heterologous transposon tagging of the DRL1 locus in Arabidopsis. Plant Cell 5:631-638 Baumann, E., Lewald, J., Saedler, H., Schulz, B., and Wisman, E. (1998) Successful PCR-based reverse genetic screens using an En-1mutagenised Arabidopsis thaliana population generated via single-seed descent. Theor. Appl. Genet. 97:729-734[CrossRef][Web of Science]. Bevan, M. et al. (1998) Analysis of a 1.9 Mb of contigous sequence from chromosome 4 of Arabidopsis thaliana.. Nature 391:485-488[CrossRef][Medline].
Bouchez, D., and Höfte, H. (1998) Functional genomics in plants. Plant Physiol. 118:725-732 Camilleri, C., Lafleuriel, J., Macadré, C., Varoquaux, F., Parmentier, Y., Picard, G., Caboche, M., and Bouchez, D. (1998) A YAC contig map of Arabidopsis thaliana chromosome 3. Plant J. 14:633-642[CrossRef][Medline]. Cardon, G.H., Frey, M., Saedler, H., and Gierl, A. (1993) Mobility of the maize transposable element En/Spm in Arabidopsis thaliana.. Plant J. 3:773-784[CrossRef][Web of Science][Medline].
(1998) Genome sequence of the nematode C. elegans: A platform for investigating biology. Science 282:2012-2018 Choi, S., Creelman, R.A., Mullet, J.E., and Wing, R.A. (1995) Construction and characterization of a bacterial artificial chromosome library of Arabidopsis thaliana.. Plant Mol. Biol. Rep. 13:124-128[Web of Science]. Das, L., and Martienssen, R. (1995) Site-selected transposon mutagenesis at the hcf106 locus in maize. Plant Cell 7:287-294[Abstract]. Endrizzi, K., Moussian, B., Haecker, A., Levin, J.Z., and Laux, T. (1996) The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE.. Plant J. 10:967-979[CrossRef][Web of Science][Medline]. Feldmann, K.A. (1991) T-DNA insertion mutagenesis in Arabidopsis: Mutational spectrum. Plant J. 1:71-82.
Goodman, H.M., Ecker, J.R., and Dean, C. (1995) The genome of Arabidopsis thaliana.. Proc. Natl. Acad. Sci. USA 92:10831-10835 Höfte, H. et al. (1993) An inventory of 1152 expressed sequence tags obtained by partial sequencing of cDNAs from Arabidopsis thaliana.. Plant J. 4:1051-1061[CrossRef][Web of Science][Medline]. James, D.W., Lim, E.J., Keller, J., Plooy, I., Ralston, E., and Dooner, H.K. (1995) Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon Activator.. Plant Cell 7:309-319[Abstract].
Jones, D.A., Thomas, C.M., Hammond-Kosack, K.E., Balint-Kurti, P.J., and Jones, J.D.G. (1994) Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science 266:789-793
Kaiser, K., and Goodwin, S.F. (1990) Site-selected transposon mutagenesis of Drosophila.. Proc. Natl. Acad. Sci. USA 87:1686-1690 Kaneko, T., Kotani, H., Nakamura, Y., Sato, S., Asamizu, E., Miyajima, N., and Tabata, S. (1998) Structural analysis of Arabidopsis thaliana chromosome 5. Sequence features of the regions of 1,381565 bp covered by twenty-one physically assigned P1 and TAC clones. DNA Res. 5:131-145[Abstract]. Klösgen, R.B., Gierl, A., Schwarz-Sommer, Z.s., and Saedler, H. (1986) Molecular analysis of the waxy locus of Zea mays. Mol. Gen. Genet. 203:237-244[CrossRef].
Koes, R. et al. (1995) Targeted gene inactivation in petunia by PCR-based selection of transposon insertion mutants. Proc. Natl. Acad. Sci. USA 92:8149-8153 Koncz, C., Nemeth, K., Redei, G.P., and Schell, J. (1992) T-DNA insertional mutagenesis in Arabidopsis.. Plant Mol. Biol. 20:963-976[CrossRef][Web of Science][Medline].
Krysan, P.J., Young, J.F., Tax, F., and Sussman, M.R. (1996) Identification of transferred DNA insertions within Arabidopsis genes involved in signal transduction and ion transport. Proc. Natl. Acad. Sci. USA 93:8145-8150 Liu, Y.G., Mitsukawa, N., Vazquez-Tello, A., and Whittier, R.F. (1995) Generation of a high quality P1 library of Arabidopsis thaliana suitable for chromosome walking. Plant J. 7:351-358[CrossRef][Web of Science]. Lolle, S.J., Cheung, A.Y., and Sussex, I.M. (1992) Fiddlehead: An Arabidopsis mutant constitutively expressing an organ fusion program that involves interactions between epidermal cells. Dev. Biol. 152:383-392[CrossRef][Web of Science][Medline]. Long, J.A., Moan, E.I., Medford, J.I., and Barton, M.K. (1996) A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis.. Nature 379:66-69[CrossRef][Medline]. Mandel, M.A., Gustafson-Brown, C., Savidge, B., and Yanofsky, M.F. (1992) Molecular characterization of the Arabidopsis floral homeotic gene APETALA1.. Nature 360:273-277[CrossRef][Medline]. McClintock, B. (1954) Mutations in maize and chromosomal aberrations in Neurospora. Carnegie Inst. Washington Yearbook 53:254-260. McKinney, E.C., Ali, N., Traut, A., Feldmann, K.A., Belostotsky, D.A., McDowell, J.M., and Meagher, R.B. (1995) Sequence-based identification of T-DNA insertion mutations in Arabidopsis actin mutants act2-1 and act4-1.. Plant J. 8:613-622[CrossRef][Web of Science][Medline].
Mena, M., Ambrose, B.A., Meeley, R.B., Briggs, S.P., Yanofsky, M.F., and Schmidt, R.J. (1996) Diversification of C-function activity in maize flower development. Science 274:1537-1540 Menssen, A., Höhmann, S., Martin, W., Schnable, P.S., Peterson, P.A., Saedler, H., and Gierl, A. (1990) The En/Spm transposable element of Zea mays contains splice sites at the termini generating a novel intron from a dSpm element in the A2 gene. EMBO J. 9:3051-3057[Web of Science][Medline]. Mewes, H.W., Albermann, K., Bähr, M., Frishman, D., Gleissner, A., Hani, J., Heumann, K., Kleine, K., Maierl, A., Oliver, S.G., Pfeiffer, F., and Zollner, A. (1997) Overview of the yeast genome. Nature 387(suppl.):7-9[Medline].
Millar, A.A., Clemens, S., Zachgo, S., Michael Giblin, A., Taylor, D.C., and Kunst, L. (1999) CUT1, an Arabidopsis gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-long-chain fatty acid condensing enzyme. Plant Cell 11:825-838 Mozo, T., Fischer, S., Meier-Ewert, S., Lehrach, H., and Altmann, T.S.O. (1998) Use of the IGF BAC library for physical mapping of the Arabidopsis thaliana genome. Plant J. 16:377-384[CrossRef][Web of Science][Medline]. Newman, T., de Bruijn, F.J., Green, P., Keegstra, K., Kende, H., McIntosh, L., Ohlrogge, J., Raikhel, N., Somerville, S., Thomashow, M., Retzel, E., and Somerville, C. (1994) Genes galore: A summary of methods for accessing results from large-scale partial sequencing of anonymous Arabidopsis cDNA clones. Plant Physiol. 106:1241-1255[Abstract]. Okuley, J., Lightner, J., Feldmann, K., Yadav, N., Lark, E., and Browse, J. (1994) Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis. Plant Cell 6:147-158[Abstract]. Pereira, A., and Aarts, M.G.M. (1998) Transposon tagging with the En-I system. In Arabidopsis Protocols, J. Martinez-Zapater and J. Salinas, eds. Totowa, NJ, Humana Press, pp. 329338. Pereira, A., and Saedler, H. (1989) Transpositional behavior of the maize En/Spm element in transgenic tobacco. EMBO J. 8:1315-1321[Web of Science][Medline]. Peterson, P. (1970) The En mutable system in maize. Theor. Appl. Genet. 40:367-377[Web of Science]. Rounsley, S.D., Glodek, A., Sutton, G., Adams, M.D., Somerville, C.R., Venter, J.C., and Kerlavage, A.R. (1996) The construction of Arabidopsis expressed sequence tag assemblies. Plant Physiol. 112:1177-1183[Abstract].
Rushforth, A.M., Saari, B., and Anderson, P. (1993) Site-selected insertion of the transposon Tc1 into a Caenorhabditis elegans myosin light chain gene. Mol. Cell. Biol. 13:902-910 Schmidt, R., West, J., Cnops, G., Love, K., Balestrazzi, A., and Dean, C. (1996) Detailed description of four YAC contigs representing 17 Mb of chromosome 4 of Arabidopsis thaliana ecotype Columbia. Plant J. 9:755-765[CrossRef][Web of Science][Medline]. Schmidt, R., Love, K., West, J., Lenehan, Z., and Dean, C. (1997) Description of 31 YAC contigs spanning the majority of Arabidopsis thaliana chromosome 5. Plant J. 11:563-573[CrossRef][Web of Science][Medline]. Schwarz-Sommer, Z.s., Shepherd, N., Tacke, E., Gierl, A., Rohde, W., Leclercq, L., Mattes, M., Berndtgen, R., Peterson, P.A., and Saedler, H. (1987) Influence of transposable elements on the structure and function of the A1 gene of Zea mays.. EMBO J. 6:287-294[Web of Science][Medline].
Winkler, R.G., Frank, M.R., Galbraith, D.W., Feyereisen, R., and Feldmann, K.A. (1998) Systematic reverse genetics of transfer-DNA-tagged lines of Arabidopsis.. Plant Physiol. 118:743-750 Wisman, E., Cardon, G.H., Fransz, P., and Saedler, H. (1998) The behaviour of the autonomous maize transposable element En/Spm in Arabidopsis thaliana allows efficient mutagenesis. Plant Mol. Biol. 37:989-999[CrossRef][Web of Science][Medline]. Yephremov, A., Wisman, E., Huijser, P., Huijser, C., Wellesen, K., and Saedler, H. (1999) Characterization of the FIDDLEHEAD gene of Arabidopsis reveals a link between adhesion response and cell differentiation in the epidermis. Plant Cell 11, in press..
Zachgo, E.A., Wang, M.L., Dewdney, J., Bouchez, D., Camilleri, C., Belmonte, S., Huang, L., Dolau, M., and Goodman, H.M. (1996) A physical map of chromosome 2 of Arabidopsis thaliana.. Genome Res. 6:19-25
Zwaal, R.R., Broeks, A., van Meurs, J., Groene, J.T.M., and Plasterk, R.H.A. (1993) Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank. Proc. Natl. Acad. Sci. USA 90:7431-7435
This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | THE PLANT CELL | PLANT PHYSIOLOGY | |
|---|---|---|---|