Plant Cell, Vol. 11, 1799-1810, September 1999, Copyright © 1999, American Society of Plant Physiologists
Identification of Two Essential Sequence Elements in the Nonconsensus Type II PatpB-290 Plastid Promoter by Using Plastid Transcription Extracts from Cultured Tobacco BY-2 Cells
Sanjay Kapoor1,a and
Masahiro Sugiuraa
a Center for Gene Research, Nagoya University, Nagoya 464-8602, Japan
Correspondence to:
Masahiro Sugiura, h44979b{at}nucc.cc.nagoya-u.ac.jp (E-mail), 81-52-789-3081 (fax)
 |
ABSTRACT |
|---|
In higher plants, plastid genes are transcribed by at least two types of DNA-dependent RNA polymerases. One of them is the well-known plastid-encoded prokaryotic type of polymerase that recognizes
70-type promoters consisting of -35 and -10 consensus elements. The other recently recognized RNA polymerase has been found to be encoded entirely in the nucleus, and it recognizes a completely different set of promoters, designated previously as nonconsensus type II (NCII) promoters. Here, we report the development of an in vitro transcription system using nonphotosynthetic plastids of cultured tobacco BY-2 cells. This system preferentially and accurately initiates transcription from NCII promoters. The conditions for in vitro transcription were optimized by using the tobacco PatpB-290 promoter, which has been found to be the most highly expressed NCII promoter in vivo. Analysis of in vitro transcription initiation in a series of PatpB-290 5' deletion constructs revealed that sequences upstream of nucleotide -41 do not influence the transcriptional activity of this promoter. A 43-bp region (nucleotides -35 to +8) was further analyzed by introducing single or multiple nucleotide substitutions into two regions (box I and box II) of high sequence conservation. We report here that the ATAGAA sequence comprising box II and the -11 to +4 region (relative to transcription initiation) in box I significantly influence the activity of this NCII promoter.
 |
INTRODUCTION |
|---|
Plastids are plant-specific organelles that possess their own genome and the capacity to express this genetic information. The transcription machinery of these organelles was considered to be similar to that of Escherichia coli, because homologs of three of the bacterial RNA polymerase subunits (
, ß, and ß') were found to be encoded on plastid genomes. Incidentally, upstream regions of most of the initially identified transcription initiation sites were found to resemble -10 and -35 consensus promoter elements (herein referred to as consensus-type [CT] promoters) typical of prokaryotic genes (reviewed in Igloi and Kossel 1992
; Gruissem and Tonkyn 1993
; Link 1994
; Hess and Borner 1999
). Moreover, transcription factors bearing resemblance to bacterial
factors were also identified as components of this transcription system (Lerbs et al. 1983
; Bulow and Link 1988
; Tiller et al. 1991
; Link 1994
; Troxler et al. 1994
; Tiller and Link 1995
; Tanaka et al. 1997
; Kestermann et al. 1998
; Tozawa et al. 1998
).
In recent years, however, several reports have helped to establish the existence of an entirely nucleus-encoded plastid RNA polymerase (NEP) in the plastids of higher plants (reviewed in Igloi and Kossel 1992
; Hess and Borner 1999
). Initial indications of completely nucleus-encoded plastid transcriptional activity came from observations of RNA synthesis in the ribosome-deficient plastids (which were presumably devoid of plastid-encoded proteins and thus of the plastid-encoded polymerase [PEP]) of heat-bleached rye seedlings and albostrian mutants of barley (Bunger and Feierabend 1980
; Siemenroth et al. 1981
). Later, it was found that only distinct sets of genes are transcribed in the ribosome-deficient plastids of heat-bleached rye seedlings (Falk, et al. 1993
), maize iojap mutants (Han et al. 1993
), and barley albostrian mutants (Hess et al. 1993
). As stronger evidence for the existence of NEP, the partial plastome of Epiphagus virginiana, which lacks functional PEP subunit genes, was found to be transcribed (dePamphilis and Palmer 1990
; Morden et al. 1991
; Ems et al. 1995
). Meanwhile, a single subunit (110 kD) RNA polymerase activity was detected in spinach chloroplast (Lerbs et al. 1985
). This activity was suggested to be the single subunit NEP or the nucleus-encoded catalytic core of a multimeric enzyme based on its functional similarity to T7 RNA polymerase (Lerbs-Mache 1993
). Recently, demonstration of transcription initiation from a few plastid genes in rpoB (an essential subunit of PEP)-deleted tobacco seedlings (achieved by plastid transformation and homologous recombination) finally and conclusively proved the existence of a plastidic transcriptional activity other than PEP (Allison et al. 1996
). By use of a similar experimental approach, it was confirmed that NEP does not share any of the core subunits of PEP (Serino and Maliga 1998
).
By analyzing the RNA species in
rpoB tobacco seedlings, translation-impaired plastids of wild-type tobacco, and nonphotosynthetic plastids of a cultured tobacco (BY-2) cell line, a number of NEP-dependent transcription initiation sites were identified and named nonconsensus type II (NCII) or NEP promoters (Allison et al. 1996
; Kapoor et al. 1997
). Sequence alignments of most of these promoters showed two regions of considerable similarity: an ~15-bp region surrounding the transcription initiation site (box I) and a 6-bp region near position -35 (box II), with reference to the site of transcription initiation (Hajdukiewicz et al. 1997
; Kapoor et al. 1997
; Miyagi et al. 1998
; Hess and Borner 1999
). Recently, similar promoters have also been identified in barley and maize, suggesting that the nucleus-encoded transcription machinery is conserved between monocots and dicots (Hubschmann and Borner 1998
; Silhavy and Maliga 1998
). These observations have revealed that box II is more conserved in monocots than in tobacco (reviewed in Hess and Borner 1999
). In addition to box I and box IIcontaining NCII promoters, there seem to be other types of NEP-recognized promoters that lack either one or both conserved boxes. For example, the maize PrpoB gene lacks box II (Silhavy and Maliga 1998
), whereas both of the conserved motifs are lacking in tobacco PclpP-53 (Sriraman et al. 1998
).
As a preliminary step toward understanding the biochemical properties and the promoter sequence requirements of the plastid-localized NEP transcription machinery, we report here the development of an in vitro transcription initiation system using the nonphotosynthetic plastids from BY-2 cells. This system effects specific and accurate transcription initiation from at least three tobacco NCII promoters. Furthermore, by using this system and a series of deletions and substitutions in the tobacco PatpB-290 (NCII) promoter region, we have identified two specific sequence elements required for correct transcription initiation.
 |
RESULTS |
|---|
Development of an NCII PromoterSpecific Plastid in Vitro Transcription System
It is known that abolition of PEP (by blocking plastid translation or deletion of rpo genes) results in a significant increase in the steady state levels of NCII transcripts, whereas abundance of transcripts resulting from CT promoters is greatly reduced in such plastids (Hess et al. 1993
; Allison et al. 1996
; Kapoor et al. 1997
; Miyagi et al. 1998
; Serino and Maliga 1998
). Similar effects on the relative abundance of two transcript types were observed in developmentally distinct (but genetically unaltered) nonphotosynthetic plastids of cultured tobacco BY-2 cells and roots of wild-type tobacco plants (Kapoor et al. 1997
; Miyagi et al. 1998
).
To ascertain whether the in vivo expression of NCII promoters in BY-2 cells also results from the activity of the NEP transcription machinery, we analyzed the effects of plastid translation and transcription inhibitors on the respective levels of representative transcripts originating from NCII (PatpB-290 and Prrn16-64) and CT (PatpB-255 and PpsbA-85) promoters (Figure 1A). In light-grown wild-type tobacco seedlings, PatpB-255 (CT)derived transcripts are ~10 times more abundant than those initiating from the NCII-type PatpB-290 (Kapoor et al. 1997
). On the other hand, in BY-2 cells, the PatpB-255derived transcripts accumulate to only 40% of the levels derived from the PatpB-290 promoter (Figure 1A, lane 1). A supplement of tagetitoxin (a PEP inhibitor) in the culture medium for 10 hr further reduced the relative amount of atpB-255 transcripts by ~15% (Figure 1A, lane 2). In BY-2 cells, the tagetitoxin-influenced reduction in the atpB-255 transcript level was not as severe as previously observed (60% reduction) in the case of young tobacco seedlings (Kapoor et al. 1997
). At present, we do not have any suitable explanation for this observation except to suggest that there may be some differences in the uptake of tagetitoxin among BY-2 cells and young seedlings.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 1.
Confirmation of NEP Activity in BY-2 Cells and Schematic Representation of the Dual Promotor Construct Used to Optimize in Vitro Transcription Reactions.
(A) Effect of plastid transcription and translation inhibitors on the in vivo abundance of individual transcripts resulting from NCII and CT promoters in BY-2 cells. Total RNA samples from BY-2 cells grown in the presence (+) or absence (-) of tagetitoxin (Tag) and spectinomycin/streptomycin (Spc/Str) were subjected to primer extension analysis using gene-specific primers. The mean relative abundance of individual transcripts, as estimated using a bioimage analyzer, is plotted in the form of a bar graph (the error bars represent the range of values from three different experiments).
(B) Growth curve for BY-2 cells and the abundance of atpB-specific transcripts. Total RNA isolated after several time periods was subjected to dot blot hybridization analysis by using a 32P-labeled atpB genespecific probe. The results were quantified and plotted as bars.
(C) Schematic representation of the atpB promoter construct used in this investigation. The in vitro transcript (bent arrows) resulting from an NCII (PatpB-290) and a CT (PatpB-255) promoter when subjected to primer extension analysis using the SKRP2 primer results in distinguishable extension products (left arrows) of 129 and 94 nucleotides (nt), respectively. Break in the atpB promoter represents ~108 bp. Vector sequences are shown by hatched rectangles.
|
|
The effect of supplementing the BY-2 culture medium with spectinomycin and streptomycin was more drastic because addition of these supplements resulted in an almost complete elimination of the PatpB-255derived transcript, with no inhibitory effect on the transcripts from PatpB-290 (Figure 1A, lane 3). Similar results were obtained for Prrn16-64 (NCII) and PpsbA-85 (CT)derived transcript levels in BY-2 cells (Figure 1A, lanes 4 to 9). Taken together, these data show that analogous to the situation in wild-type tobacco chloroplasts, in the plastids of BY-2 cells, the NCII promoters are utilized by the NEP transcription machinery. However, in contrast to chloroplasts, NEP transcription activity seemed to be much higher than the PEP activity in the nonphotosynthetic plastids of BY-2 cells.
Therefore, the cultured tobacco BY-2 cell line, which makes large quantities of developmentally homogenous cells easier to obtain, was selected as starting material for the preparation of NEP-specific transcription extracts. The relative abundance of NCII transcripts was not found to vary significantly during the growth of the cell culture (Figure 1B). The mid-log phase, however, had previously been shown to be high in RNA synthesis and low in RNase activities (Fan and Sugiura 1995
). Moreover, under our experimental conditions, the BY-2 cells harvested at the mid-log phase yielded a higher percentage of intact plastids. Therefore, this stage of cell growth was selected for preparation of the plastid in vitro transcription system. To minimize contamination from other cell compartments, we used a gentle approach involving protoplast preparation (Fan and Sugiura 1995
). After physically disrupting the BY-2 protoplasts, intact nonphotosynthetic plastids were purified by differential centrifugation followed by sucrose step gradient centrifugation. The transcription extracts were prepared after disruption of purified plastids by sonication.
Optimization of in Vitro Transcription Reaction
The conditions for the in vitro transcription reaction were optimized by using two adjacent atpB promoters, PatpB-255, a CT promoter, and PatpB-290, an NCII promoter, cloned in the pBluescript II SK+ vector (Figure 1C). The PatpB-290 transcript is one of the most abundant among several NCII transcripts that have been analyzed. Moreover, the inherent proximity of the PatpB-255 and PatpB-290 promoters provided a unique opportunity to analyze the activity of two functionally distinct promoters in a single assay (Kapoor et al. 1997
). The relative transcription activity of these two promoters was assayed by primer extension of in vitro transcripts using a 27-nucleotide primer complementary to the 3' vector sequence. Selection of a primer complementary to vector sequences significantly reduces the background due to in vivo transcripts as well as nonspecific transcription from endogenous DNA. The transcription initiation sites for the tobacco atpB/E promoters were mapped previously (Orozco et al. 1990
; Kapoor et al. 1994
, Kapoor et al. 1997
; Hajdukiewicz et al. 1997
). Therefore, the dual promoter construct used in this investigation was expected to yield two extension products of 94 and 129 nucleotides for PatpB-255 and PatpB-290, respectively (Figure 1C).
Following the lead of earlier published results on PEP-specific plastid transcription extracts (Bottomley et al. 1971
; Sun et al. 1986
, Sun et al. 1989
; Tiller and Link 1993
), preliminary Mg2+ and K+ concentrations for the in vitro transcription reaction were set at 7 and 50 mM, respectively, at pH 8.0. Under these conditions, in vitro transcription followed by a primer extension assay yielded several nonspecific (
150 nucleotides) extension products in addition to those corresponding to PatpB-255 and PatpB-290 (see, e.g., Figure 2A, lanes 3 to 5 and 10). However, after optimizing the reaction conditions for in vitro transcription to 20 mM Mg2+, 100 to 125 mM K+, and pH 7.8, specific transcription from the PatpB-290 (NCII) promoter was observed (Figure 2A and Figure 2B). The peak of transcription activity was obtained by using 84 nM template DNA, although this concentration also resulted in relatively higher background (Figure 2C). Therefore, for routine transcription assays, 42 nM template DNA was used. Transcription activity was also dependent on total protein concentration (optimal at 1.2 mg mL-1) as well as reaction time (optimal at 40 min; data not shown). Using this system, we could not detect any specific transcription activity from linear DNA templates. The best results were obtained with templates that were purified by using CsCl density gradient centrifugation and that contained <5% of DNA in linearized form (data not shown).

View larger version (52K):
[in this window]
[in a new window]
|
Figure 2.
Optimization of in Vitro Transcription Reaction Conditions with Respect to K+ and Mg+1 Concentrations, pH, and Template Amount.
The atpB promoter construct (Figure 1C) was in vitro transcribed as described in Methods. The relative transcription activity of PatpB-290 and PatpB-255 promoters (marked as -290 and -255, respectively) was assayed by primer extension of in vitro transcripts using the SKRP2 primer and analyzed on sequencing gels. The factors varied during in vitro transcription reactions are shown at the top of each panel. The solid triangles represent relative increase or decrease in the units of the respective variable factor. Numbers at the left of each panel are the sizes (in nucleotides) of marker DNA fragments.
(A) Effect of K+ and Mg+1 concentrations on in vitro transcription.
(B) Effect of pH.
(C) Effect of template amount.
|
|
Effect of Transcription Inhibitors
The in vitro transcription reaction using the atpB promoter construct and the BY-2 extract under the optimized conditions produced two discrete bands of the predicted sizes corresponding to PatpB-255 and PatpB-290derived transcripts (Figure 3A, lanes BEx). The site of in vitro transcription initiation was authenticated by electrophoresing the extended products simultaneously with the corresponding sequence ladder (Figure 3A). The relative levels of in vitrotranscribed products from PatpB-290 and PatpB-255 were found to be similar to their respective in vivo levels in BY-2 cells. It should be mentioned, however, that because the reaction conditions were optimized for NCII promoters, occasionally the activity of PatpB-255 (CT promoter) was lower than expected. This template, when transcribed in vitro by using tobacco chloroplast extracts, produced relatively high- level transcription from the PatpB-255 gene, but no in vitrotranscribed products corresponding to the PatpB-290 (NCII) promoter were detected (Figure 3A, lanes CEx). The addition of tagetitoxin (100 µM) had little or no effect on the abundance of the PatpB-290 (NCII)derived transcript. However, it caused ~50% reduction in the levels of the PatpB-255derived transcript (Figure 3B, lane Tag+). A few rather longer transcript species were detected with the chloroplast extract, which might have resulted from nonspecific transcription initiation and/or priming by the SKRP2 primer that was used during the primer extension reactions (Figure 3A).

View larger version (67K):
[in this window]
[in a new window]
|
Figure 3.
Determination of in Vitro Transcription Initiation Site and the Effect of Transcription Inhibitors on Respective Transcription Initiation from NCII (PatpB-290) and CT (PatpB-255) atpB Promoters.
(A) The atpB promoter construct (Figure 1C) was in vitro transcribed by using transcription extracts from BY-2 plastids (BEx) and leaf chloroplasts of wild-type tobacco seedlings (CEx). The SKRP2 primer extension products resulting from the relative transcription activity of PatpB-290 and PatpB-255 promoters (marked as -290 and -255, respectively) were analyzed on a sequencing gel alongside a sequence ladder (lanes T, G, C, and A), which was generated by the same set of primer and template DNA. Tag, tagetitoxin.
(B) The in vitro transcription reactions obtained by using BY-2 plastid extract and the atpB promoter construct were supplemented with Tagetitoxin (Tag; 100 µM), rifampicin (Rif; 1 µg mL-1), and -amanitin ( -ama; 250 µg mL-1). The bands corresponding to -290 and -255 represent the relative amounts of in vitrotranscribed products resulting from PatpB-290 and PatpB-255, respectively. Numbers at left are the sizes (in nucleotides) of marker DNA fragments .
|
|
Sensitivity of the BY-2 plastid extract to other transcription inhibitors was also analyzed by supplementing the reaction mixture with 1 and 250 µg mL-1 of rifampicin and
-amanitin, respectively (Figure 3B). No measurable effects of either of the inhibitors were noted, suggesting that NCII-specific polymerase activity was due neither to contamination by nuclear RNA polymerases nor to the prokaryotic-type RNA polymerase. Hence, finding an inhibitor(s) specific for this newly characterized polymerase (NEP) activity would lead to a deeper understanding of its function.
In Vitro Transcription Initiation from Other NCII Promoters
Correct transcription initiation from two other NCII promoters, Prrn16-64 and Prpl32-1019 (Vera and Sugiura 1995
; Allison et al. 1996
; Vera et al. 1996
; Kapoor et al. 1997
), was also achieved using this in vitro transcription system (Figure 4). The construct containing both P1 and P2 promoters of tobacco rpl32 (see Methods) yielded only a single band (113 bp) corresponding to the NCII Prpl32-1019 (P2) promoter. In the case of the rrn16 promoter construct, however, in vitro transcripts initiating from both P1 (Prrn16-114 [CT]) and P2 (Prrn16-64 [NCII]) were detected, although the level of the Prrn16-114 transcript, which is the major in vivo 16S pre-rRNA transcript in photosynthetic plastids (Vera and Sugiura 1995
), was
50% of that of the Prrn16-64 (NCII)derived transcript. These results once again suggest that NCII promoters are more efficiently utilized by this transcription system.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 4.
In Vitro Transcription from Tobacco Prpl32-1019 (P2) and Prrn16-114 and Prrn16-64 (NCII) Promoters Along with That from PatpB-290.
The genes are indicated at top; the respective in vivo transcript initiation sites are shown at right; sizes (in nucleotides) of marker DNA fragments are shown at left.
|
|
Identification of Sequences Required for Correct Transcription Initiation
Sequence alignments of the known NCII promoters revealed two regions of considerable similarity, hereafter referred to as box I (the sequence around the transcription start site) and box II (the sequence ~35 bp upstream of the transcription start site; represented by a few examples in Figure 5). To analyze the importance of these two regions and to determine the sequences necessary for the nucleus-encoded machinery to initiate transcription from NCII promoters, we constructed a number of PatpB-290 promoter constructs with a series of deletion and substitution mutations (Figure 6A and Figure 7A) in the region upstream of the -290 atpB transcription initiation site. Serial deletions from nucleotides -210 to -41 did not have any measurable adverse effect on transcription from the PatpB-290 promoter; however, deletion of the region upstream of position -4 considerably reduced its in vitro activity to negligible levels, thereby suggesting that the cis elements necessary for transcription from the PatpB-290 (NCII) promoter resided downstream of the -41 position (Figure 6B). Incidentally, this is the region that encompasses the conserved boxes I and II.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 5.
Sequence Alignment of NCII Promoters.
Transcription initiation sites are marked with a bent arrow. Conserved motifs (box I and box II) are indicated. The sequence motif showing partial conservation of the mitochondrial YRTA motif is underlined. The 3' A-rich region is shown in white letters on a black background. Dashes indicate nonconserved regions. Boldface letters represent the conserved nucleotides in box II. An AT-rich region in box I is shown in italic letters.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
Figure 6.
In Vitro Transcription from a Series of Truncated atpB Promoter Constructs.
(A) Schematic representation of the deletion (D) mutations in the atpB promoter construct described in Figure 1C. The deleted portions are shown by broken lines. Two regions (box I and box II) of high sequence conservation among known NCII promoter regions are shown as I and II, respectively. The in vivo transcription initiation sites (-290 and -255) are indicated with arrows; vector sequence (Seq.) is shown as black rectangles; open rectangles represent the transcripts initiating from PatpB-290. WT, wild-type PatpB promoter without any modification.
(B) Results of in vitro transcription reactions using deletion constructs. The respective in vivo transcript initiation sites are displayed at right. The extract concentration (Conc.) control band in each lane represents a 192-bp 32P-labeled polymerase chain reaction (PCR) fragment that was mixed with the BY-2 in vitro transcription extract before its distribution to individual reactions, thereby creating an internal standard for the amount of extract added to each reaction mixture. The bands corresponding to -290 and -255 represent the relative amounts of in vitrotranscribed products resulting from PatpB-290 and PatpB-255, respectively. Numbers at left are the sizes (in nucleotides) of marker DNA fragments. An ~130-nucleotide band (marked with an asterisk) that was detected occasionally might have resulted from nonspecific primer extension and/or transcription. WT, wild-type PatpB-290 promoter without any modification.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
Figure 7.
Significance of Sequences in the Conserved Regions of the PatpB-290 (NCII) Promoter for in Vitro Transcription.
(A) Seven constructs (S1 to S7) with base substitutions at several positions in the conserved (box I and box II) and nonconserved regions of the PatpB-290 promoter were prepared. The substitutions in the PatpB-290 promoter sequence are marked by dashed lines. The conserved sequences are shown in boldface. The boxed sequence in box I represents the -35 region of PatpB-255, a downstream CT promoter.
(B) Gel showing respective in vitro transcription initiation activity of all the base substitution promoter constructs described in (A). The extract concentration (Conc.) control band in each lane represents a 192-bp 32P-labeled PCR fragment that was mixed with the BY-2 in vitro transcription extract before its distribution to individual reactions, thereby creating an internal standard for the amount of extract added into each reaction mixture. The bands corresponding to -290 and -255 represent the relative amounts of in vitrotranscribed products resulting from PatpB-290 and PatpB-255, respectively. Numbers at left are the sizes (in nucleotides) of marker DNA fragments. WT, wild-type PatpB-290 promoter without any modification.
|
|
To further analyze the specific sequences involved in NCII transcription, we prepared seven (S1 to S7) -290 atpB promoter constructs with up to six A
T and C
G (except the transcription initiation site at which T was substituted by C) base substitution mutations and analyzed them for in vitro transcription activity (Figure 7A and Figure 7B). Replacement of six of the most conserved base pairs (ATAGAA) in box II (Figure 7; construct S1 and lane S1) caused an ~60% reduction in the transcription activity of the PatpB-290 promoter. Similar severe losses of transcription activity were observed when changes in the transcription initiation site itself (Figure 7, construct S5 and lane S5) or the adjacent upstream region (nucleotides -9 to -11, included in box I) were made (Figure 7, construct S3 and lane S3). A 3-bp change (nucleotides +2 to +4) immediately downstream of the transcription initiation site also affected transcription efficiency, albeit slightly (~20%). Interestingly, substitution of the -3 to -6 ATAG with TATC almost abolished transcription activity (Figure 7, construct S4 and lane S4). However, mutating three of the downstream AAT bases (Figure 7, construct S7 and lane S7) that were found to be fairly well conserved did not have any impact on the transcription activity from this promoter. The substitution S3 in the nonconserved region (in between boxes I and II) also did not have any effect on transcription activity (Figure 7B, lane S3). Taken together, these results suggest that both conserved boxes I and II are necessary components of the PatpB-290 promoter and that they are sufficient for accurate transcription.
As far as PatpB-255 is concerned, none of the mutations in the upstream region of PatpB-290 affected its in vitro transcription activity. However, a three-base change (AGA
TCT) corresponding to +2 to +4 of PatpB-290 considerably reduced the amount of in vitrotranscribed RNA from PatpB-255. Incidentally, the PatpB-290 region between +1 and +6 also represents the -35 region of PatpB-255 (a CT promoter), which is known to be important for the efficiency of CT promoters. Therefore, any disruption in this region would have affected the activity of the PatpB-255 promoter.
 |
DISCUSSION |
|---|
In this study, we characterize two important sequence elements in PatpB-290 (an NCII promoter) by using an in vitro transcription approach. To determine their significance, we first developed an in vitro transcription system using nonphotosynthetic plastids of cultured tobacco BY-2 cells. This system was tested for accuracy of transcription initiation by using three NCII promoters, namely, PatpB-290, Prrn16-64, and Prpl32-1019. Analysis of a series of PatpB-290 5' deletion constructs suggested that sequences upstream of nucleotide -41 did not influence transcription initiation in vitro. Further characterization of this promoter by using base substitutions in a 43-bp region (from nucleotides -35 to +8) revealed that two regions of high sequence similarity (box I and box II), which have been observed in several NCII promoters (Kapoor et al. 1997
; Miyagi et al. 1998
; Hess and Borner 1999
), were in fact involved in the process of transcription initiation. Whereas most of the base changes in box I and box II (S1, S3, and S5) caused an ~40 to 60% decrease, a 3-bp change from nucleotides -6 to -3 (S4) resulted in a severe reduction (~90%) in PatpB-290 promoter activity. The latter region has been found to be fairly well conserved among most of the NCII/NEP promoters identified in tobacco (Hajdukiewicz et al. 1997
; Kapoor et al. 1997
; Hubschmann and Borner 1998
; Miyagi et al. 1998
) and maize (Silhavy and Maliga 1998
).
Recently, in vitro characterization of the tobacco PrpoB-345 promoter element revealed that a CAT motif spanning nucleotides -8 to -6 is critical for transcription activity (Liere and Maliga 1999
). The CAT motif of the tobacco PrpoB-345 promoter is well conserved in PatpB-290 (nucleotides -7 to -4). A severe reduction of PatpB-290 activity caused by the replacement of three bases (ATA to TAT) in this motif further validates its importance for NEP activity. This region also corresponds to a significant YRTA core sequence motif that is found in most plant mitochondrial promoters (reviewed in Hess and Borner 1999
), suggesting that mitochondrial RNA polymerase and the plastid NEP share considerable similarity.
As far as minimal sequence requirements for transcription initiation are concerned, PatpB-290 (described in this study) seems to differ from the recently characterized PrpoB-345 promoter (Liere and Maliga 1999
). Our data suggest that both box I and box II are important for PatpB-290 activity, whereas, in the case of PrpoB-345, only a 15-bp sequence (nucleotides -14 to +1, equivalent to box I) was shown to be sufficient for full promoter activity. Although there is a great degree of similarity in the box I region of these two promoters, PrpoB-345 completely lacks any region similar to box II. In addition to the tobacco PrpoB-345, PclpP-511 (Hajdukiewicz et al. 1997
) in tobacco and PrpoB in maize (Silhavy and Maliga 1998
) have also been found to lack sequence conservation in the box II region. clpP-53 is another NEP-transcribed RNA that lacks both box I and box II (Sriraman et al. 1998
). Most of the other NEP-utilized promoters identified to date, namely, tobacco Prrn16-64 (Vera and Sugiura 1995
; Allison et al. 1996
), Prpl32-1019 (Vera et al. 1996
), PatpI-208 (Hajdukiewicz et al. 1997
; Miyagi et al. 1998
), and PclpP-173 (Hajdukiewicz et al. 1997
), contain sequences similar to both box I and box II. Coincidentally, all of the genes containing box I and box IItype NCII promoters are transcribed from multiple promoters, and at least one of those promoters is a CT promoter.
When compared with nonphotosynthetic plastids, the abundance of transcript initiating from the box I and box IIcontaining NCII promoters is greatly reduced in chloroplasts in which PEP takes over the major responsibility for plastid transcription (Allison et al. 1996
; Kapoor et al. 1997
). On the other hand, promoters that lack either box II, namely, PrpoB-345, PclpP-511 (Silhavy and Maliga 1998
), and PaccD-129 (Hajdukiewicz et al. 1997
), or both of the conserved boxes, for example, PclpP-53 (Sriraman et al. 1998
), have been found in the 5' regions of those genes for which either all or a major share of the respective transcript pool in chloroplasts is contributed by NEP-driven transcription. The tobacco accD and rpoB genes have been shown to be transcribed from single promoters that are utilized by NEP (Hajdukiewicz et al. 1997
; Liere and Maliga 1999
). In the case of clpP, although one of the four promoters is a CT-utilized promoter (PclpP-95), a NEP-utilized promoter (PclpP-53) contributes significantly to the clpP transcript pool in chloroplasts (Hajdukiewicz et al. 1997
). Therefore, to cope with the requirements of developing plastids, transcription from these promoters (which lack either one or both of the conserved boxes) might have to be regulated in a different manner than those sharing transcriptional responsibilities with CT promoters. In fact, rpoB transcription in barley has been shown to increase severalfold before the remainder of the photosynthesis-related genes (Baumgartner et al. 1993
). Based on the above-mentioned argument, we postulate that there might exist a correlation between the structure and regulation of NEP-utilized promoters.
The NCII-specific NEP activity described here has previously been shown to be functionally (Allison et al. 1996
; Kapoor et al. 1997
) and structurally (Serino and Maliga 1998
) distinct from the PEP. The first nonplastid-encoded RNA polymerase activity, however, was characterized from spinach as a 110-kD single subunit activity (Lerbs-Mache 1993
). This RNA polymerase was demonstrated to utilize phage T7 and a non-CT plastid (Prrn16PC) spinach promoter. We were, however, unable to detect any specific transcription from either the T3 or the T7 promoter by using tobacco BY-2 extracts (data not shown). Moreover, the spinach Prrn16PC promoter (utilized by the single subunit spinach RNA polymerase) does not show any significant similarity to the conserved regions of NCII promoters characterized thus far. In tobacco, clpP (encoding the catalytic subunit of a Clp ATP-dependent protease) gene expression also has been characterized as NEP dependent. Because the clpP promoter (PclpP-53) does not exhibit any similarity to any other NEP-utilized (NCII) promoter, it has been categorized separately and is believed to be transcribed by the NEP in conjunction with a specificity factor (Sriraman et al. 1998
). Paradoxically, the NEP machinery has been demonstrated to be fairly well conserved among dicots and monocots, exemplified by faithful transcription from maize rpoB and rice PclpP-111 promoters that was obtained by using an in vitro (Liere and Maliga 1999
) and in vivo (Sriraman et al. 1998
) approaches, respectively, with the tobacco NEP. It would therefore be interesting to analyze whether the RNA polymerase utilizing spinach Prrn16PC and tobacco PclpP-53 promoters represents only a modified form of the NEP or constitutes an altogether different polymerase.
A promising candidate for the gene encoding the plastid NEP has been recently identified from Arabidopsis (Hedtke et al. 1997
). This gene (RPOZ) has been reported to be fairly similar (55% identical residues) to its mitochondrial counterpart RPOY, and its 5' coding region resembles the sequence of a plastid-targeting transit peptide. Most of the NCII/NEP promoters characterized thus far contain a core YATA sequence that is very similar to the mitochondrial promoter core (YRTA) sequence, thus indicating that Arabidopsis RPOZ could very well be the gene encoding the catalytic subunit of NEP. This gene has been predicted to produce a protein of 113 kD, which is very much in agreement with the size ascribed to the spinach NEP activity (Lerbs-Mache 1993
). To date, there is no experimental proof that RPOZ in fact encodes plastid NEP. Once determined, it would be interesting to analyze how it relates to the NEP activities of tobacco and spinach.
It certainly seems that the plastid transcription machinery is not as simple as it appeared to be a few years ago. We hope that the in vitro transcription system described here will help to answer at least some of the questions concerning the nucleus-encoded plastid-localized DNA-dependent RNA polymerase.
 |
METHODS |
|---|
Plant Materials
Tobacco (Nicotiana tabacum) BY-2 cells were grown in modified Murashige and Skoog medium (Wako Pure Chemicals, Osaka, Japan), as described previously (Fan and Sugiura 1995
). The suspension cultures were maintained by transferring aliquots to fresh medium (3:100) weekly and shaking at 130 rpm in the dark at 27° C. Cells were collected at mid-log phase (80 to 86 hr after inoculation) by passage through Miracloth (Calbiochem, San Diego, CA). For inhibition of plastid protein synthesis, we supplemented the BY-2 culture medium with 200 µg mL-1 (each) spectinomycin and streptomycin after 40 hr of growth in modified Murashige and Skoog medium alone. Tagetitoxin treatment was also given in a similar manner by adding the toxin to a growing culture at a final concentration of 100 µM. Seedlings of wild-type tobacco variety BY-4 were raised in a growth chamber (28°C with continuous light) for 25 days.
Purification of BY-2 Plastids and Preparation of Plastid Transcription Extracts
Protoplast Preparation
Preparation of plastids from BY-2 cells, barring some minor modification, was essentially as described by Nemoto et al. 1988
. BY-2 cells, which were collected from a 2-L suspension 80- to 84-hr culture (~200 g fresh weight), were washed twice with 0.4 M mannitol, pH 5.0, and digested in 3 volumes of enzyme solution (1% Onozuka-RS cellulase [Yakult, Tokyo] and 0.1% pectolyase Y-23 [Kikkoman, Tokyo] in modified Murashige and Skoog medium containing 0.4 M mannitol, pH 5.4) at 30°C for 45 min (Nagata et al. 1981
; Fan and Sugiura 1995
). Protoplasts were harvested by centrifugation at 200g for 5 min at 2°C followed by three washes with 5 volumes each of ice-cold 0.4 M mannitol, pH 5.0. The pellet was suspended in plastid isolation buffer (0.4 M mannitol, 20 mM Tris-HCl, pH 7.6, 0.5 mM EDTA, 1.2 mM spermidine, 7 mM ß-mercaptoethanol, 0.6% [w/v] polyvinylpyrrolidone [PVP], and 0.1% [w/v] BSA).
Protoplast Lysis and Proplastid Purification
The protoplasts were broken by passing the suspension through two layers of 20-µm nylon mesh under mild vacuum (changing the mesh after every 40 mL). The suspension of broken protoplasts was then centrifuged at 250g for 5 min at 2°C to pellet cell debris and nuclei. The supernatant was filtered through two layers of 10-µm nylon mesh under gravitational force. Percoll was added to the filtrate to a final concentration of 15%. The proplastids were pelleted by centrifugation at 15,000g for 20 min at 2°C and suspended in 4 volumes of plastid isolation buffer. The proplastids were further purified from mitochondria and nuclear debris by sucrose density gradient centrifugation (30 to 50 to 70% sucrose in 20 mM Tris-HCl, pH 7.6, 0.5 mM EDTA, 1.2 mM spermidine, and 7 mM ß-mercaptoethanol) at 1800g for 40 min at 2°C in a swinging bucket rotor. A yellow band of purified plastids that formed at the 50 to 70% sucrose interface was collected, diluted five times with plastid isolation buffer (minus PVP and BSA), and centrifuged at 4000g for 5 min at 2°C.
Lysis of Proplastids
The resulting loose pellet was suspended in 1 volume of lysis buffer (50 mM Tricine-KOH, pH 8, 50 mM KCl, 0.5 mM EDTA, 0.5 mM DTT, 0.5 mM phenylmethylsulphonyl fluoride, 1 mM benzamidine, 5 mM
-amino-n-caproic acid, and 5% [v/v] glycerol). The plastids were disrupted by sonication twice for 10 sec at power seven using a Handy Sonic sonicator (model UR-20P; Tomy, Tokyo, Japan) and centrifuged at 50,000g for 30 min at 2°C. The supernatant was dialyzed against 200 volumes of fresh lysis buffer for 3 hr at 2°C. The resulting extract was divided into 30-µL aliquots, flash frozen in liquid nitrogen, and stored at -80°C for up to 1 month. Typically, 500 µL of plastid extract containing 20 to 25 mg mL-1 protein was obtained from 200 g of BY-2 cells. Chloroplast transcription extracts were prepared from 100 g of young expanded (3- to 6-cm) leaves. The chloroplasts were prepared according to Bartlett et al. 1982
and lysed as described by Orozco et al. 1986
. The subsequent steps were the same as described above for the BY-2 cells.
Determination of Mitochondrial Contamination
The procedure of Nemoto et al. 1988
for proplastid preparation was expected to yield extremely pure plastids from BY-2 cells. However, to be doubly sure of the extent of mitochondrial contamination, we subjected aliquots (50-µg protein equivalent) from several stages of plastid purification (protoplast preparation, protoplast lysis, pellet obtained after Percoll gradient centrifugation, and upper and lower bands obtained after sucrose density gradient centrifugation) to a cytochrome c oxidase assay (Orii and Okunuki 1965
). The final plastid preparation was devoid of any detectable cytochrome c oxidase activity (data not shown).
Construction of DNA Templates
Unless indicated otherwise, all techniques used for manipulating nucleic acids were as described by Sambrook et al. 1989
. The tobacco atpB 5' upstream region from positions -212 to -479 relative to the ATG codon of the ATP-synthase ß subunit (positions 56,981 to 57,248 of the tobacco chloroplast DNA) was polymerase chain reaction (PCR) amplified by using primers PA1 (GTATGGATCCATCTCAAGTGGATGAATCAGAATCTTGAG) and PA2 (CAGATCTAGATA-CGGAATTCCTCTATGAATCTATGAAAGG), which contain BamHI and XbaI sites (underlined), respectively, using pTB27 from the tobacco chloroplast clone bank as the template (Sugiura et al. 1986
). The resulting fragment was digested with BamHI and XbaI and cloned at corresponding sites in pBluescript II SK+ (Stratagene, La Jolla, CA) and amplified in Escherichia coli XL-1 Blue cells (Stratagene). The rrn16 and rpl32 promoter (corresponding to positions 102,531 to 102,757 and 113,761 to 114,000 of tobacco chloroplast DNA, respectively) constructs were prepared in a similar manner, using the same cloning sites as described above. The atpB promoter 5' serial deletion constructs were prepared by inverse PCR using appropriate primer pairs. The base substitution mutations in the promoter region were introduced by using the Transformer site-directed mutagenesis kit version 2 (Clontech, Palo Alto, CA). All of the constructs were verified by sequence analysis. To be used as templates, all of the plasmids were isolated by using the alkaline lysis method and purified by CsCl density gradient centrifugation.
In Vitro Transcription Reaction
A typical in vitro transcription reaction was performed at 30°C for 40 min in a 50-µL total volume, containing 50 mM Tris-HCl, pH 7.8, 100 mM KCl, 20 mM MgCl2, 2 mM DTT, 10 units of RNase inhibitor, 0.5 mM each nucleotide triphosphate (NTP), 42 nM template DNA, and 60 µg of protein from the plastid extract. All of the components except for the NTPs were mixed and preincubated on ice for 10 min, and the reaction was initiated by adding 2 µL of a 12.5 mM solution of each of the four NTPs. The reaction was stopped by extracting it with an equal volume of phenolchloroformisoamyl alcohol (25:24:1 [v/v]). To the resulting aqueous phase, 0.1 pmol of a 5' 32P-labeled primer SKRP2 (5'-TCGACGGTATCGATAAGCTTGATATC-3') complementary to the vector (pBluescript SK+) sequence (positions 675 to 700) was added, and the nucleic acids were precipitated by adding 0.1 volume of 3 M sodium acetate and 2 volumes of ethanol. After washing once with 70% ethanol, the pellet was air dried and dissolved in 12.5 µL of reverse transcriptase buffer. Primer annealing was performed by heating the templateprimer mixture at 70°C for 5 min followed by a 5-min incubation at 65°C and then gradually (3°C per min) cooling to 42°C. The deoxynucleotide triphosphates (1 mM each) and 10 units of avian myeloblastosis reverse transcriptase were added while the reaction mixture was still at 42°C, and primer extension was performed at the same temperature for 45 min. For the experiments shown in Figure 6 and Figure 7, avian myeloblastosis reverse transcriptase was replaced with ReverTra Ace (Moloney murine leukemia virus reverse transcriptase without RNase H activity; Toyobo Biochemicals, Osaka, Japan), and primer extension was performed at 50°C for 45 min. After precipitating with 2 volumes of ethanol, the DNA pellet was dissolved in 5 µL of loading buffer (25 mM Tris-HCl, pH 8, 20 mM EDTA, pH 8, 0.5% bromophenol blue, 0.5% xylene cyanol, and 50% formamide). The samples were denatured at 95°C for 4 min and resolved on 6% denaturing polyacrylamide gels, and the results were analyzed by using a bioimage analyzer (model BAS-2000; Fuji Photo Film Co., Tokyo).
During transcription analysis of deletion and substitution mutations (Figure 6 and Figure 7), a 192-bp 32P-labeled PCR fragment was mixed with the proplastid in vitro transcription extract before its distribution to individual reactions, thereby creating an internal standard for the amount of extract added to each reaction mixture. This fragment was prepared by PCR amplification of a pBluescript SK+ multiple cloning site by using 32P-labeled T3 and M13 -20 primers followed by gel purification (QIAquick gel purification kit; Qiagen, Chatsworth, CA).
 |
FOOTNOTES |
|---|
1 Current address: Laboratory of Developmental Biology, National Institute of Agrobiological Resources, Tsukuba Science City 305-8602, Japan. 
 |
ACKNOWLEDGMENTS |
|---|
We thank Drs. Yoshinori Toyoshima, Mamoru Sugita, Hiroshi Takatsuji, Tetsuro Hirose, and Yasushi Yukawa for helpful discussions, Drs. Meenu Kapoor and Zbigniew Rybka for critical reading of the manuscript, and Dr. Naoki Takaya for help in experiments involving cytochrome c oxidase estimation. This work was supported by grants-in-aid from the Ministry of Education and Culture, Japan. S.K. was supported by a postdoctoral fellowship of the Japanese Society for the Promotion of Science.
Received April 12, 1999; accepted June 12, 1999.
 |
REFERENCES |
|---|
Allison, L.A., Simon, L.D., and Maliga, P. (1996) Deletion of rpoB reveals a second distinct transcription system in plastids of higher plants. EMBO J. 15:2802-2809[Web of Science][Medline].
Bartlett, S.G., Grossmann, A.R., and Chua, N.-H. (1982) In vitro synthesis and uptake of cytoplasmically-synthesized chloroplast proteins. In Edelman M., Hallick R.B., Chua N.-H., eds. Methods in Chloroplast Molecular Biology. New York, Elsevier. 10811091.pp.
Baumgartner, B.J., Rapp, J.C., and Mullet, J.E. (1993) Plastid genes encoding the transcription/translation apparatus are differentially transcribed early in barley (Hordeum vulgare) chloroplast development. Plant Physiol. 101:781-791[Abstract].
Bottomley, W., Spencer, D., Wheeler, A.M., and Whitfeld, P.R. (1971) The effect of a range of RNA polymerase inhibitors on RNA synthesis in higher plant chloroplasts and nuclei. Arch. Biochem. Biophys. 143:269-275[Medline].
Bülow, S., and Link, G. (1988) Sigma-like activity from mustard (Sinapis alba L.) chloroplast conferring DNA-binding and transcription specificity to E. coli core RNA polymerase. Plant Mol. Biol. 10:349-357[CrossRef].
Bünger, W., and Feierabend, J. (1980) Capacity of RNA synthesis in 70S ribosome-deficient plastids of heat-bleached rye leaves. Planta 149:163-169[CrossRef].
dePamphilis, C.W., and Palmer, J.D. (1990) Loss of photosynthetic and chlororespiratory genes from the plastid genome of a parasitic flowering plant. Nature 348:337-339[CrossRef][Medline].
Ems, S., Morden, C.W., Dixon, C., Wolfe, K.H., dePamphilis, C.W., and Palmer, J.D. (1995) Transcription, splicing and editing of plastid RNAs in the nonphotosynthetic plant Epiphagus virginiana. Plant Mol. Biol. 29:721-733[CrossRef][Web of Science][Medline].
Falk, J., Schmidt, A., and Krupinska, K. (1993) Characterization of plastid DNA transcription by ribosome of heat-bleached barley leaves. J. Plant Physiol. 141:176-181.
Fan, H., and Sugiura, M. (1995) A plant basal in vitro system supporting accurate transcription of both RNA polymerase II and IIIdependent genes: Supplement of green leaf component(s) drives accurate transcription of a light-responsive rbcS gene. EMBO J. 14:1024-1031[Web of Science][Medline].
Gruissem, W., and Tonkyn, J.C. (1993) Control mechanisms of plastid gene expression. Crit. Rev. Plant Sci. 121:19-55.
Hajdukiewicz, P.T., Allison, L.A., and Maliga, P. (1997) The two RNA polymerases encoded by the nuclear and the plastid compartments transcribe distinct groups of genes in tobacco plastids. EMBO J. 16:4041-4048[CrossRef][Web of Science][Medline].
Han, C.D., Patrie, W., Polacco, M., and Coe, E.H. (1993) Aberrations in plastid transcripts and deficiency of plastid DNA in striped and albino mutants in maize. Planta 191:552-563.
Hedtke, B., Börner, T., and Weihe, A. (1997) Mitochondrial and chloroplast phage-type RNA polymerases in Arabidopsis. Science 277:809-811[Abstract/Free Full Text].
Hess, W., and Börner, T. (1999) Organellar RNA polymerase of higher plants. Int. Rev. Cytol. 190:1-59[Web of Science][Medline].
Hess, W.R., Prombona, A., Fieder, B., Subramanian, A.R., and Börner, T. (1993) Chloroplast rps15 and the rpoB/C1/C2 gene cluster are strongly transcribed in ribosome-deficient plastids: Evidence for a functioning non-chloroplast-encoded RNA polymerase. EMBO J. 12:563-571[Web of Science][Medline].
Hübschmann, T., and Börner, T. (1998) Characterization of transcript initiation sites in ribosome-deficient barley plastids. Plant Mol. Biol. 36:493-496[CrossRef][Web of Science][Medline].
Igloi, G.L., and Kössel, H. (1992) The transcription apparatus of chloroplasts. Crit. Rev. Plant Sci. 10:525-558.
Kapoor, S., Wakasugi, T., Deno, H., and Sugiura, M. (1994) An atpE-specific promoter within the coding region of the atpB gene in tobacco chloroplast DNA. Curr. Genet. 26:263-268[CrossRef][Web of Science][Medline].
Kapoor, S., Suzuki, J.Y., and Sugiura, M. (1997) Identification and functional significance of a new class of non-consensus-type plastid promoters. Plant J. 11:327-337[CrossRef][Web of Science][Medline].
Kestermann, M., Neukirchen, S., Kloppstech, K., and Link, G. (1998) Sequence and expression characteristics of a nuclear encoded chloroplast sigma factor from mustard (Sinapis alba). Nucleic Acids Res. 26:2747-2753[Abstract/Free Full Text].
Lerbs, S., Bräutigam, E., and Mache, R. (1983) DNA-dependent RNA polymerase of spinach chloroplasts: Characterization of sigma-like and alpha-like polypeptides. Mol. Gen. Genet. 211:459-464.
Lerbs, S., Bräutigam, E., and Parthier, B. (1985) Polypeptides in DNA-dependent RNA polymerase of spinach chloroplasts: Characterization by anti-body-linked polymerase assay and determination of sites of synthesis. EMBO J. 4:1661-1666[Web of Science][Medline].
Lerbs-Mache, S. (1993) The 110-kDa polypeptide of spinach plastid DNA-dependent RNA polymerase: Single-subunit enzyme or catalytic core of multimeric enzyme complexes? Proc. Natl. Acad. Sci. USA 90:5509-5513[Abstract/Free Full Text].
Liere, K., and Maliga, P. (1999) In vitro characterization of the tobacco rpoB promoter reveals a core sequence motif conserved between phage-type plastid and mitochondrial promoters. EMBO J. 18:249-257[CrossRef][Web of Science][Medline].
Link, G. (1994) Plastid differentiation: Organelle promoters and transcription factors. Results Probl. Cell Differ. 20:65-85[Medline].
Miyagi, T., Kapoor, S., Sugita, M., and Sugiura, M. (1998) Transcript analysis of the tobacco plastid operon rps2/atpI/H/F/A reveals the existence of a non-consensus type II (NCII) promoter upstream of the atpI coding sequence. Mol. Gen. Genet. 257:299-307[CrossRef][Web of Science][Medline].
Morden, C.W., Wolfe, K.H., dePamphilis, C.W., and Palmer, J.D. (1991) Plastid translation and transcription genes in a non-photosynthetic plant: Intact, missing and pseudo genes. EMBO J. 10:3281-3288[Web of Science][Medline].
Nagata, T., Okada, K., Takebe, I., and Mitsui, C. (1981) Delivery of tobacco mosaic virus RNA into plant protoplasts mediated by reverse-phase evaporation vesicles (liposomes). Mol. Gen. Genet. 184:161-165.
Nemoto, Y., Kawano, S., Nakamura, S., Mita, T., Nagata, T., and Kuroiwa, T. (1988) Studies on plastid-nuclei (nucleoids) in Nicotiana tabacum L. I. Isolation of proplastid-nuclei from cultured cells and identification of proplastid-nuclear proteins. Plant Cell Physiol. 29:167-177[Abstract/Free Full Text].
Orii, Y., and Okunuki, K. (1965) Cytochrome oxidase activity of the Okunuki preparation and its activation by heat, alkali and detergent treatments. J. Biochem. 58:561-568[Free Full Text].
Orozco, E.M., Jr., Mullet, J.E., Hanley-Bowdoin, L., and Chua, N.-H. (1986) In vitro transcription of chloroplast protein genes. Methods Enzymol. 118:232-253[Medline].
Orozco, E.M., Jr., Chen, L.J., and Eilers, R.J. (1990) The divergently transcribed rbcL and atpB genes of tobacco plastid DNA are separated by nineteen base pairs. Curr. Genet. 17:65-71[Medline].
Sambrook, J., Fritsch, E.F., and Manniatis, T. (1989) Molecular Cloning: A Laboratory Mannual. 2nd ed Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press.
Serino, G., and Maliga, P. (1998) RNA polymerase subunits encoded by the plastid rpo genes are not shared with the nucleus-encoded plastid enzyme. Plant Physiol. 117:1165-1170[Abstract/Free Full Text].
Siemenroth, A., Wollgiehn, R., Neumann, D., and Börner, T. (1981) Synthesis of ribosomal RNA in ribosome-deficient plastids of the mutant "albostrians" of Hordeum vulgare L. Planta 153:547-555[CrossRef].
Silhavy, D., and Maliga, P. (1998) Mapping of promoters for the nucleus-encoded plastid RNA polymerase (NEP) in the iojap maize mutant. Curr. Genet. 33:340-344[CrossRef][Web of Science][Medline].
Sriraman, P., Silhavy, D., and Maliga, P. (1998) The phage-type PclpP-53 plastid promoter comprises sequences downstream of the transcription initiation site. Nucleic Acids Res. 26:4874-4879[Abstract/Free Full Text].
Sugiura, M., Shinozaki, K., Zaita, N., Kusuda, J., and Kumano, M. (1986) Clone bank of the tobacco (Nicotiana tabacum) chloroplast genome as a set of overlapping restriction endonuclease fragments: Mapping of eleven ribosomal protein genes. Plant Sci. 44:211-216[CrossRef].
Sun, E., Shapiro, D.R., Wu, B.W., and Tewari, K.K. (1986) Specific in vitro transcription of 16S rRNA gene by pea chloroplast RNA polymerase. Plant Mol. Biol. 6:429-439.
Sun, E., Wu, B.W., and Tewari, K.K. (1989) In vitro analysis of the pea chloroplast 16S rRNA gene promoter. Mol. Cell. Biol. 9:5650-5659[Abstract/Free Full Text].
Tanaka, K., Tozawa, Y., Mochizuki, N., Shinozaki, K., Nagatani, A., Wakasa, K., and Takahashi, H. (1997) Characterization of three cDNA species encoding plastid RNA polymerase sigma factors in Arabidopsis thaliana: Evidence for the sigma factor heterogeneity in higher plant plastids. FEBS Lett. 413:309-313[CrossRef][Web of Science][Medline].
Tiller, K., and Link, G. (1993) Phosphorylation and dephosphorylation affect functional characteristics of chloroplast and etioplast transcription systems from mustard (Sinapis alba L.). EMBO J. 12:1745-1753[Web of Science][Medline].
Tiller, K., and Link, G. (1995) Sigma-like plastid transcription factors. Methods Mol. Biol. 37:337-348[Medline].
Tiller, K., Eisermann, A., and Link, G. (1991) The chloroplast transcription apparatus from mustard (Sinapis alba L.). Evidence for three different transcription factors which resemble bacterial sigma factors. Eur. J. Biochem. 198:93-99[Medline].
Tozawa, Y., Tanaka, K., Takahashi, H., and Wakasa, K. (1998) Nuclear encoding of a plastid sigma factor in rice and its tissue- and light-dependent expression. Nucleic Acids Res. 26:415-419[Abstract/Free Full Text].
Troxler, R.F., Zhang, F., Hu, J., and Bogorad, L. (1994) Evidence that sigma factors are components of chloroplast RNA polymerase. Plant Physiol. 104:753-759[Abstract].
Vera, A., and Sugiura, M. (1995) Chloroplast rRNA transcription from structurally different tandem promoters: An additional novel-type promoter. Curr. Genet. 27:280-284[CrossRef][Web of Science][Medline].
Vera, A., Hirose, T., and Sugiura, M. (1996) A ribosomal protein gene (rpl32) from tobacco chloroplast DNA is transcribed from alternative promoters: Similarities in promoter region organization in plastid housekeeping genes. Mol. Gen. Genet. 251:518-525[Medline].