Plant Cell, Vol. 12, 535-546, April 2000, Copyright © 2000, American Society of Plant Physiologists
Cosuppression of a Plasma Membrane H+-ATPase Isoform Impairs Sucrose Translocation, Stomatal Opening, Plant Growth, and Male Fertility
Rongmin Zhaoa,
Vincent Dielenb,
Jean-Marie Kinetb, and
Marc Boutrya
a Unité de Biochimie Physiologique, Université Catholique de Louvain, Croix du Sud, 2-20, B1348, Louvain-la-Neuve, Belgium
b Unité de Botanique Générale, Université Catholique de Louvain, Croix du Sud, 2-20, B1348, Louvain-la-Neuve, Belgium
Correspondence to:
Marc Boutry, boutry{at}fysa.ucl.ac.be (E-mail), 32-10-473872 (fax)
 |
ABSTRACT |
|---|
The plasma membrane H+-ATPase builds up a pH and potential gradient across the plasma membrane, thus activating a series of secondary ion and metabolite transporters. pma4 (for plasma membrane H+-ATPase 4), the most widely expressed H+-ATPase isogene in Nicotiana plumbaginifolia, was overexpressed in tobacco. Plants that overexpressed PMA4 showed no major changes in plant growth under normal conditions. However, two transformants were identified by their stunted growth, slow leaf initiation, delayed stem bolting and flowering, and male sterility. Protein gel blot analysis showed that expression of the endogenous and transgenic pma4 was cosuppressed. Cosuppression was developmentally regulated because PMA4 was still present in developing leaves but was not detected in mature leaves. The glucose and fructose content increased threefold, whereas the sucrose content remained unchanged. The rate of sucrose exudation from mature leaves was reduced threefold and the sugar content of apical buds was reduced twofold, suggesting failure of sucrose loading and translocation to the sink tissues. Cosuppression of PMA4 also affected the guard cells, stomatal opening, and photosynthesis in mature leaves. These results show that a single H+-ATPase isoform plays a major role in several transport-dependent physiological processes.
|
|
INTRODUCTION |
|---|
The plasma membrane proton-translocating ATPase (H+-ATPase) acts as a primary transporter that pumps protons out of the cell, thus creating a pH and electrical potential gradient across the plasma membrane that in turn activates many secondary transporters involved in ion and metabolite uptake (reviewed in Serrano 1989 
; Sussman 1994 ; Michelet and Boutry 1995 ; Palmgren 1998 ). H+-ATPase is encoded by a gene family of ~10 members that are differentially expressed depending on the cell type, developmental stage, and environmental factors (Ewing and Bennett 1994 ; Harper et al. 1994 ; Michelet et al. 1994 ; Moriau et al. 1999 ; Oufattole et al. 2000 ). All of the genes encoding H+-ATPases that have thus far been isolated as cDNA clones belong to two subfamilies, which probably represent the most highly expressed H+-ATPases (Moriau et al. 1999 ). Possible functional differences between H+-ATPase isoforms belonging to the same or different subfamilies have been studied using the heterologous expression in yeast of Arabidopsis and Nicotiana plumbaginifolia H+-ATPase genes. Three Arabidopsis H+-ATPase genes (aha1, aha2, and aha3, for Arabidopsis H+-ATPases 1, 2, and 3) belonging to the same subfamily have been shown to have different kinetic parameters (Palmgren and Christensen 1994 ), whereas two N. plumbaginifolia genes belonging to different subfamilies (pma2 and pma4, for plasma membrane H+-ATPases 2 and 4) were shown not only to have different kinetics but also to confer different sensitivity of yeast growth to the external pH (Luo et al. 1999 ).
Although these data clearly suggest that the plant H+-ATPases are not functionally identical, it remains to be established whether this is also the case in the plant and what the significance of this might be for transport activation. For instance, study of Arabidopsis H+-ATPase gene expression suggests that certain H+-ATPase isoforms might be specialized in different major transport functions (e.g., mineral nutrition, phloem loading, or stomatal opening) (DeWitt et al. 1991 ; Harper et al. 1994 ; DeWitt and Sussman 1995 ). The situation is different in N. plumbaginifolia, in which at least two genes (pma2 and pma4) are expressed in many cell types and with a partial overlap (Moriau et al. 1999 ; Oufattole et al. 2000 ). Whatever the case may be, a functional study of H+-ATPase isoforms in the plant is required to clarify the relationship between H+-ATPase expression and activity and plant physiology. Young et al. 1998 recently took a further step toward this goal. They analyzed Arabidopsis transgenic plants expressing the AHA3 H+-ATPase with an altered C terminus. When grown in vitro, the Arabidopsis transformants were more resistant to acid medium, thus suggesting a role for the plasma membrane H+-ATPase in cytoplasmic pH homeostasis.
In N. plumbaginifolia, nine pma genes have been identified (Perez et al. 1992 ; Moriau et al. 1999 ; Oufattole et al. 2000 ). Studies with seven of them with the ß-glucuronidase (gusA) reporter gene have clearly indicated that subfamilies I (pma1, pma2, and pma3) and II (pma4) represent the major genes expressed in this species. pma2 and pma4 were also shown to be expressed in several different cell types, such as root epidermis and hairs, phloem companion cells, guard cells, and most parts of flower organs. Moreover, these two genes appear to be coexpressed in certain cell types at the same developmental stage (Moriau et al. 1999 ), thus making their individual characterization difficult. Because the properties of their encoded products (expressed in yeast) are different (Luo et al. 1999 ), it is of the utmost interest to develop tools to study the roles of a single isoform in the plant.
In this study, we report an attempt to modify the in-the-plant expression of pma4 by introducing pma4 under the control of its own promoter but activated by the cauliflower mosaic virus (CaMV) 35S enhancer into tobacco plants. Several PMA4-overexpressing plants and three PMA4-cosuppressing plants were identified. Because the latter grew slowly and were male sterile, they were studied in more detail. PMA4 cosuppression was developmentally regulated in the leaves and was associated with several defects, such as impaired sucrose translocation from the mature leaves, impaired stomatal opening, and male infertility. We conclude that pma4 is a major H+-ATPase gene involved in several aspects of plant physiology.
|
|
RESULTS |
|---|
Identification of pma4-Overexpressing or pma4-Cosuppressing Transgenic Tobacco
To determine the specific physiologic roles of pma4, we overexpressed it under the control of a strong transcription promoter. Instead of CaMV 35S, a commonly used promoter, we chose to retain the pma4 promoter but reinforce it by inserting the CaMV 35S enhancer sequence (Fang et al. 1989 ). Transient and stable transformation with the gusA reporter gene, fused to the enhanced pma4 promoter, showed the latter to have a much greater activity than the native pma promoter and to retain a broad range of tissue specificity (Zhao et al. 1999 ).
We designed three different constructs (Fig 1). P4pma4 was the pma4 cDNA linked to a 2.32-kb genomic fragment containing the pma4 upstream region, which has been shown to confer gusA expression on many cell types (Moriau et al. 1999 ). The 500pma4 construct was similar to P4pma4, except that the CaMV 35S enhancer was inserted 500 nucleotides upstream of the pma4 transcription initiation site. Because overexpression of the transcript might induce downregulation of the enzyme, we also designed 500pma4
, a construct identical to 500pma4 except that the last 103 C-terminal codons were deleted. This region is thought to be an autoinhibitory regulatory domain (Palmgren et al. 1991 ) such that its deletion in PMA4 expressed in yeast constitutively activates the enzyme (Luo et al. 1999 ).
View larger version (17K):
[in this window]
[in a new window]
|
Figure 1.
Constructs for PMA4 Overexpression.
The three constructs bring together the transcription promoter region of pma4, the pma cDNA, and the nopaline synthase polyadenylation site and terminator (Tnos). In 500pma4 and 500pma4, the CaMV 35S enhancer (EN) was inserted 500 nucleotides upstream of the pma4 transcription start site. In 500pma4, the last 103 C-terminal codons of the pma4 cDNA were truncated.
|
|
Transgenic tobacco leaves were screened by using protein gel blot analysis with antibodies raised against peptides specific to either subfamily I (PMA1, PMA2, and PMA3) or subfamily II (PMA4) (Moriau et al. 1999 ). The P4pma4 transformants did not show important PMA4 overexpression (Fig 2A) and were not studied further. In contrast, of the 27 500pma4 and 20 500pma4 primary transgenic plants analyzed, 15 and 10 plants, respectively, showed at least twofold overexpression of PMA4 (examples shown in Fig 2B and Fig 2C). In 500pma4 plants, the size of the new product (~95 kD) was as expected for the C-terminal–deleted PMA4. Finally, we detected three transgenic plants, line 30 from 500pma4 and lines 44 and 45 from 500pma4, in which expression of both endogenous and transgenic pma4 was considerably reduced (Fig 2B and Fig 2C), suggesting a cosuppression phenomenon.
View larger version (47K):
[in this window]
[in a new window]
|
Figure 2.
Immunodetection of H+-ATPase in Leaf Microsomes from Primary Transgenic Plants.
(A) P4pma4 transgenic plants.
(B) 500pma4 transgenic plants.
(C) 500pma4 transgenic plants.
Microsomal proteins (5 µg) from mature leaves were electrophoresed and subjected to immunodetection (protein gel blotting) with antibodies raised against the first (PMA1, PMA2, and PMA3 [PMA1-3]) or second (PMA4) H+-ATPase subfamilies. The identification number of each transgenic plant is indicated at the top. SR1 is an untransformed wild-type plant. The apparent size of the proteins immunodetected is indicated at right.
|
|
pma4 Cosuppression Results in Stunted and Delayed Growth and Male Sterility
Overexpressing 500pma4 and 500pma4 plants did not display any major growth modification under normal greenhouse conditions (data not shown), whereas growth of the cosuppressing plants was markedly reduced (Fig 3A to 3C). Flowering of all three cosuppressing plants was delayed. The anther filaments were shorter, and after anther dehiscence, all of the pollen grains were found to be shriveled (Fig 3D). The flowers were male sterile but could be pollinated with wild-type pollen.
View larger version (41K):
[in this window]
[in a new window]
|
Figure 3.
Phenotype of the pma4-Cosuppressing Plants.
(A) Eight-week-old plant of cosuppressing line 30 of the F2 generation (left) and a wild-type SR1 (right) plant.
(B) Eight-week-old plant of cosuppressing line 45 of the F2 generation (left) and a wild-type SR1 (right) plant.
(C) Seventh leaf from a plant of cosuppressing line 45 of the F2 generation (left) and a wild-type SR1 (right) plant.
(D) Flowers from a wild-type SR1 plant (left) and a plant of cosuppressing line 45 (right).
|
|
Line 44 (500pma4) showed a variable cosuppression phenotype in the F1 generation and was not studied further. Lines 30 (500pma4) and 45 (500pma4) produced plants with the same stunted phenotype up to at least the third generation. DNA gel blot analysis indicated that line 30 contained three independent transgenic inserts (loci a, b, and c; data not shown). For the F1 generation, analysis of 16 cosuppressing offspring showed that they carried, at minimum, loci b and c. Other combinations of loci resulted in PMA4 overexpression instead of cosuppression (data not shown). In line 45, a single insert was identified by DNA gel blot analysis, and cosegregation of kanamycin resistance and cosuppression were inherited as a single locus in the F1 and F2 generations.
The retarded development of the mutants was easily distinguishable from the normal development of the wild type (Fig 3A and Fig 3B). Although leaf emergence was delayed in plants from lines 30 and 45, the total number of leaves produced up to the flowering stage was higher per plant in these lines (Fig 4A), another reflection of flower induction being delayed. Because of the shorter internodes, stem bolting was also reduced (Fig 4B). Although the young expanding leaves displayed no significant morphological differences compared with the wild type, the fully expanded leaves of the mutants were smaller during the first growth stage (Fig 4C). In addition, the first mature leaves soon stopped growing at the tip and turned yellow. As a result, the leaves were pear shaped (Fig 3C). In some seriously stunted plants, the first four or five leaves rapidly became necrotic. As occurs with the primary transgenic plants, all of the F1 and F2 pma4-cosuppressing plants were male sterile, with shorter filaments (Fig 3D) and shriveled pollen.
View larger version (18K):
[in this window]
[in a new window]
|
Figure 4.
Growth Comparison between Wild-Type and pma4-Co suppressing Plants.
(A) Number of leaves (minimal length of 5 mm).
(B) Stem length.
(C) Length of fully expanded leaves.
Seeds from wild-type and pma4-cosuppressing lines 30 and 45 of the F2 generation were sown in 96-well culture plates in sterile soil. After 30 days, the plants were transferred to pots and grown at 26°C (daytime at 50 µmol m-2 sec-1 at the stem base level for 16 hr) and 20°C (night). Leaf (minimum length of 5 mm) number, stem height, and fully expanded leaf length were scored until flowering for 12 plants each of the wild-type SR1 (open squares) and cosuppressing lines 30 F2 (open circles) and 45 F2 (open triangles). The error bars represent the 95% confidence interval.
|
|
pma4 Cosuppression Is Developmentally Regulated
Protein gel blot analysis of microsomal fractions showed that pma4 cosuppression was severe in the roots, stem, and anthers. In the petals, the shorter transgenic PMA4 was barely detected, whereas the full-length endogenous PMA4 was expressed at a lower level (Fig 5). In stunted plants, PMA4 expression was still seen in the young leaves but was drastically reduced in the fully expanded leaves, whereas wild-type leaves at this position expressed more PMA4 (Fig 6A). To determine whether cosuppression was intrinsic to leaf position or the developmental stage of the leaf, we conducted immunodetection experiments with a leaf at the same position for plants of differing ages. PMA4 expression was gradually cosuppressed with leaf maturation (Fig 6B). Finally, analysis of various regions of a single developing leaf showed more severe PMA4 cosuppression at the leaf tip, followed by the edge, thus following the maturation gradient within the leaf (Fig 6C). These data indicate that PMA4 cosuppression is developmentally regulated. In contrast, PMA1 to PMA3 expression was not substantially altered.
View larger version (42K):
[in this window]
[in a new window]
|
Figure 5.
Immunodetection of H+-ATPase in Roots, Stem, Anthers, and Petals.
Microsomal proteins (5 µg) from the roots, stem, anthers, and petals of wild-type (W) and cosuppressing lines 30 and 45 F2 (30 and 45) plants were analyzed by protein gel blotting with antibodies raised against PMA4 or PMA1, PMA2, and PMA3 (PMA1-3). The apparent size of the proteins immunodetected is indicated at right.
|
|
View larger version (47K):
[in this window]
[in a new window]
|
Figure 6.
Immunodetection of H+-ATPase in Leaves at Different Developmental Stages.
Microsomal proteins (5 µg) from wild-type SR1 and F2 plants of cosuppressing lines 30 and 45 were analyzed by protein gel blotting with antibodies raised against PMA4 or PMA2.
(A) Microsomes were prepared from leaves at different positions on 2-month-old plants. Lane 1 represents the top unexpanded leaf (~0.5 cm long); lanes 2 to 4 represent the second, third, and fourth leaves from the top.
(B) Microsomes were prepared from the tenth leaf of plants at different developmental stages. Lane 1 represents the early developmental stage (~2.5 cm long); lanes 2 and 3 represent the development stages at 3 and 6 days later.
(C) Microsomes were prepared from different regions within the 10th developing leaf (SR1, ~12 cm total length; lines 30 and 45, ~8 cm total length). Lanes 1 to 4 indicate the base (1) and center (2) of the leaf, the edge in the middle of the leaf (3), and the tip of the leaf (4).
|
|
pma4 Cosuppression Reduces ATPase Activity
Protein gel blot analysis showed that PMA4 expression in cosuppressing plants was drastically reduced. However, the plants expressed H+-ATPase isoforms other than PMA4, including PMA1, PMA2, and PMA3, which were shown to be present in normal amounts. To determine the effect of pma4 cosuppression on the whole H+-ATPase family, we measured H+-ATPase activity in a purified plasma membrane fraction. Specific ATPase activity in leaves of PMA4-cosuppressing plants (0.24 ± 0.07 and 0.33 ± 0.11 µmol Pi min-1 mg protein-1 for F2 plants of lines 30 and 45, respectively) was reduced to 40 to 50% of that in wild-type leaves (0.66 ± 0.17 µmol Pi min-1 mg protein-1).
pma4 Cosuppression Modifies Leaf Sugar Content
We then determined what the effects of altered pma4 expression might be, first focusing on sugar translocation between the source and sink tissues. Apoplastic phloem loading has been supported in several species by the identification of H+/sucrose symporters and by the effects of antisense RNA expression (Riesmeier et al. 1993 ; Gahrtz et al. 1994 ; Sauer and Stolz 1994 ; Kuhn et al. 1996 ; Burkle et al. 1998 ). pma4 is expressed in various cell types but predominantly in phloem tissues, suggesting that PMA4 activates sugar loading (Moriau et al. 1999 ). The total soluble sugar content was threefold greater in mature leaves of the two cosuppressing plants than in wild-type leaves (Fig 7A). Analysis of individual sugars confirmed these data and showed that the higher content of soluble sugars in cosuppressing leaves resulted from accumulation of glucose and fructose, whereas sucrose content was not particularly altered (Fig 7A). In contrast, the starch content of cosuppressing leaves was much less than that of the wild type. This was independent of the light conditions because the content of soluble sugars and starch measured in line 45 plants grown under different light conditions (46 to 185 µmol m-2 sec-1; Table 1) was in each case higher (soluble sugars) or lower (starch) in the cosuppressing plants than in the wild type.
View larger version (22K):
[in this window]
[in a new window]
|
Figure 7.
Leaf Carbohydrate Content and Invertase Activity.
(A) and (B) Carbohydrates in fully expanded leaves and in apical buds, including young leaves (<4 cm long), respectively.
(C) Invertase activity in fully expanded leaves.
The sugars were extracted from 7-week-old wild-type SR1 plants (open bars) and F2 plants of lines 30 (hatched bars) and 45 (filled bars) under a light intensity of ~50 (stem base) to 200 (flower) µmol m-2 sec-1 at 26°C for 16 hr during the day and 20°C at night collected after 8 hr of illumination. Total soluble sugars (Soluble) and starch were determined by using the anthrone reagent. Sucrose (Suc), glucose (Glc), and fructose (Fru) were determined by quantitative HPLC. Alkaline, acid, and wall-bound invertase activities were determined in extracts from the fully expanded leaves. The coded bars and error bars represent the mean and 95% confidence interval, respectively, from four independent assays of wild-type and F2 cosuppressing plants. FW, fresh weight.
|
|
Plant invertase has been shown to be involved in regulating sucrose metabolism (Huber 1989 ). Expression of a yeast invertase in tobacco and Arabidopsis produces an accumulation of carbohydrates in leaves and results in growth retardation (von Schaewen et al. 1990 ; Sonnewald et al. 1991 ). The increased amounts of hexoses seen in the cosuppressing mature leaves could therefore result from increased invertase activity. When soluble and wall-bound invertases were measured, they were in all cases found to be substantially increased in the mutants (Fig 7C).
We then focused on the sucrose content of the aerial sink tissues (Fig 7B). The apical tissue of cosuppressing lines showed 29 to 71% less sugar content for sucrose, glucose, and fructose alike. These data suggested that sugar translocation between the source and sink tissues was not operating properly. When we tested this more directly by measuring the sucrose content of the exudate from detached mature leaves, threefold less sucrose was exudated from the cosuppressing plants when compared with the wild type (Fig 8). Moreover, although the cosuppressing leaves accumulated glucose and fructose, only slight traces of glucose and fructose were found in the exudate (data not shown). Taken together, these data indicate that pma4 cosuppression in mature leaves resulted in reduced sucrose translocation from the source to the sink organs.
View larger version (32K):
[in this window]
[in a new window]
|
Figure 8.
Sucrose Exudation from Detached Mature Leaves.
Exudate was collected from fully expanded leaves of wild-type SR1 and F2 plants from cosuppressing lines 30 and 45; the sucrose concentrations were quantified and expressed as micromoles of sucrose per gram fresh weight (FW) of leaves. The coded bars and error bars represent the mean and 95% confidence interval, respectively, of six independent assays.
|
|
pma4 Cosuppression Alters Stomata Functioning
Because pma4 is also expressed in guard cells, we next analyzed these cells. In young leaves, in which pma4 was still being expressed, there was no real difference between wild-type and cosuppressing plants in terms of the shape or size of the epidermal cells, including the guard cells (Fig 9A and Fig 9B). In the fully expanded leaves, however, the cells of the cosuppressing plants were larger than those of the wild type. The guard cells appeared shriveled and many stomata seemed almost closed, whereas those of the wild type were open (Fig 9C and Fig 9D). When we applied fusicoccin, a fungal phytotoxin known to stimulate H+-ATPase and widen the stomata (Marre 1979 ; De Boer 1997 ), the aperture of most of the wild-type stomata increased, whereas almost 50% of the cosuppressing plant stomata failed to open (Fig 9E, Fig 9F, and Fig 9I).
View larger version (51K):
[in this window]
[in a new window]
|
Figure 9.
Stomatal Opening in Young and Fully Expanded Leaves.
The epidermis of young and fully expanded leaves from 2-month-old plants was peeled off and incubated in the presence or absence of 10 µM fusicoccin (FC), as indicated in Methods.
(A) Wild-type SR1 young leaf.
(B) Young leaf from an F2 line 30 plant.
(C) Wild-type SR1 fully expanded leaf not exposed to fusicoccin.
(D) Fully expanded leaf from an F2 line 30 plant not exposed to fusicoccin.
(E) and (G) Wild-type SR1 fully expanded leaf treated with fusicoccin and stained with fluorescein diacetate.
(F) and (H) Fully expanded leaf from an F2 line 30 plant treated with fusicoccin and stained with fluorescein diacetate.
(E) and (F) were photographed in white light; (G) and (H) were photographed under UV light to reveal fluorescence. Bar below (H) = 100 µm.
(I) The distribution of stomata as a function of their aperture is shown for the samples corresponding to (C) to (H). The data represent the mean stoma aperture for at least 100 stomata on each of three leaves.
|
|
Fluorescein diacetate (Widholm 1972 ) was applied to test the plasma membrane potential of the guard cells. This nonfluorescent ester readily crosses the cell membrane, where it is cleaved by intracellular esterases; the released polar fluorescein moiety then accumulates within the living cells (Rotman and Papermaster 1966 ). In mature leaves, most wild-type guard cells but only a few of those in cosuppressing plants were strongly fluorescent (Fig 9G and Fig 9H). This suggests that most of the mutant guard cells had a reduced membrane potential. In developing leaves, abnormal guard cells first occurred in the tip region and increased in number after leaf maturation (data not shown). This indicates that irregular guard cells occurred only at a later developmental stage and that this might be closely associated with pma4 cosuppression. Because the size of the stomata aperture controls gas exchange, we also measured CO2 consumption and calculated the net photosynthesis rate in mature leaves under normal growth conditions and found this to be reduced by 25 to 39% in the cosuppressing plants (Table 2).
Finally, because pma4 cosuppression might also affect mineral nutrition and therefore nitrogen supply, we measured the total nitrogen content of mature leaves. No significant difference was found between the two mutants and wild-type plants (Table 3).
|
|
DISCUSSION |
|---|
Overexpression of pma4 was achieved using the two constructs 500pma4 and 500pma4. Approximately half of the primary transgenic plants assayed showed a marked overexpression of intact or (to a lesser extent) C terminus–truncated PMA4. Although the PMA4-overexpressing plants showed no major changes under normal greenhouse conditions, a more detailed analysis should be performed, for instance, by challenging growth under stress conditions; indeed, expression of C-terminal–modified Arabidopsis AHA3 H+-ATPase resulted in an increased resistance of seedlings grown in vitro under acid conditions, but no modified phenotype was observed under normal conditions (Young et al. 1998 ).
Three cases of pma4 cosuppression appeared at the heterozygous stage; in two, this was stably inherited up to at least the third generation. pma4 cosuppression was developmentally regulated in the leaves. Cosuppression was partial in developing leaves but almost total in mature leaves. This was observed when comparing different leaves from a single plant at the same time, different stages of development of the same leaf, or even different parts of a single developing leaf. Other cases of developmentally regulated cosuppression have been reported in transgenic tobacco, for example, with the genes encoding nitrate reductase (Dorlhac de Borne et al. 1994 ), chitinase (Hart et al. 1992 ), or glucanase (de Carvalho Niebel et al. 1995 ). We hypothesize that transgene expression increases with leaf maturation and, at a certain stage, reaches a threshold necessary to induce cosuppression. In fact, a gusA reporter gene study has shown that GUS activity, whether conferred by the native or the enhanced pma4 promoter in transgenic plants, increases after leaf maturation (data not shown). Our hypothesis was confirmed by the observation that the PMA4/PMA1 to PMA3 ratio, determined by protein gel blot analysis (Fig 6), increased during leaf development. This modification of pma4 expression might correspond to the sink–source transition that probably correlates with the activation of the sucrose loading process.
Among the nine N. plumbaginifolia pma genes, pma4 is the most highly expressed (Moriau et al. 1999 ; Oufattole et al. 2000 ). Expression was found in many cell types, including root epidermal cells, companion cells, and guard cells. However, the expression pattern of pma2 overlaps to a large extent with that of pma4. The consequences of pma4 cosuppression might therefore be expected to range from no effect whatsoever, if pma2 alone is able to sustain the transport function, to a major effect if pma4 plays a preponderant role. The latter case was experimentally proven because pma4 cosuppression resulted in alteration of several physiologic traits, such as stomata opening, photosynthesis, sugar translocation, stem bolting, and male fertility. This list is probably not exhaustive. Therefore, we must analyze these pleiotropic physiologic alterations cautiously when trying to relate a specific functional defect to PMA4 cosuppression in a particular type of cell. Long-distance and multifactorial effects are possible, and regulatory systems presumably not adapted to the PMA4 absence might respond in unexpected ways. With these reservations in mind, we can now attempt to interpret some of the phenotypic modifications at the molecular level.
Stomatal opening is induced by increased turgor pressure as a result of K+ and anion influx energized by H+-ATPase. In pma4-cosuppressing leaves but not in young developing leaves, most of the stomata were closed and could not be opened by treatment with fusicoccin; however, some stomata still responded to fusicoccin treatment, and some even had a larger stomatal aperture than that seen in the wild type. Because cosuppression is developmentally regulated, perhaps it did not occur evenly in every cell, so pma4 was still normally expressed in those few guard cells that still functioned well. Although guard cells have active chloroplasts, they also rely on the import of carbohydrates (Lu et al. 1997 ). Defective carbohydrate transfer to and uptake by guard cells might reduce ATP supply and therefore contribute to the failure of stomatal opening. A major consequence of the ineffective stomata opening seems to be a decreased CO2 uptake, which one would expect to affect the carbohydrate metabolism.
pma4 cosuppression caused reduced sucrose translocation from source leaves and a lower sugar content in sink tissues. According to the apoplastic phloem loading hypothesis, photoassimilates synthesized in the source mesophyll are released into the apoplasm, taken up into the phloem companion cells or sieve elements by way of H+/sucrose cotransporters, and then translocated to sink organs (reviewed in Ward et al. 1998 ). The plasma membrane H+-ATPase creates a proton gradient across the plasma membrane to energize this loading process. H+-ATPases and H+/sucrose transporters are therefore the two key partners for phloem loading. Disruption of the latter reportedly leads to failure of sucrose loading in Solanaceae, for instance, in the case of antisense inhibition of H+/sucrose symporter gene expression (Riesmeier et al. 1994 ; Kuhn et al. 1996 ; Burkle et al. 1998 ). Moreover, hydrolysis of sucrose in the apoplasm by ectopic expression of invertase (von Schaewen et al. 1990 ; Sonnewald et al. 1991 ) or a reduced energy supply in the companion cells as a result of ectopic expression of pyrophosphatase (Lerchl et al. 1995 ; Geigenberger et al. 1996 ) results in reduced sucrose translocation and produces a crinkled phenotype.
This study demonstrates that disruption of the other partner by pma4 cosuppression had a similar effect. Although gusA expression driven by the pma4 promoter has been detected in companion cells (Moriau et al. 1999 ), characterization of the potato sucrose transporter, SUT1, supports the hypothesis that the mRNA synthesized in the companion cell is transported to the sieve element, where sucrose loading occurs (Kuhn et al. 1997 ). Determining whether the proton gradient failure occurs in the companion cells or the sieve elements therefore requires detailed in situ H+-ATPase RNA and protein localization, together with pH imaging.
Although sucrose translocation was defective, the sucrose content in mature leaves remained at the same level as in the wild type, but glucose and fructose content markedly increased. This most probably results from the invertase activity induced in the cosuppressing plants. Whether this induction is a direct result of the failure of sucrose loading or is another effect of cosuppression (e.g., reduced CO2 uptake) requires additional examination to determine, such as measuring the sugar content in the apoplasm and within the cells.
Transgenic plants in which sucrose loading is impaired by downregulation of the sucrose/H+ transporter (Riesmeier et al. 1994 ; Kuhn et al. 1996 ; Burkle et al. 1998 ) or by ectopic expression of yeast-derived invertase (Sonnewald et al. 1991 ) accumulate more sucrose and have a greater starch content in the mature leaves. This contrasts with the results observed with the pma4-cosuppressing plants. Indeed, despite the reduced translocation and the increased glucose and fructose content, if we take the starch into account, the mature leaves accumulated less total carbohydrate than did those of the wild-type plant (Fig 7A and Table 1). Abnormal stomatal functioning and the resulting limitation of gas exchange and photosynthesis is the most plausible explanation for this phenotype. However, given the wide expression pattern of pma4, we cannot exclude that the important modification in carbohydrate metabolism and transport is a secondary effect of pma4 cosuppression in a cell type not discussed so far or results from a disturbed regulatory mechanism.
Floral initiation was delayed in the cosuppressing plants. This might be related to the reduced sugar input to the apical meristem, because sucrose has been suggested to play an essential role in floral initiation (reviewed in Bernier et al. 1993 ). Delayed flowering has also been observed in cases in which sucrose translocation was reduced (Sonnewald et al. 1991 ; Kuhn et al. 1996 ; Burkle et al. 1998 ). In addition, the pma4-cosuppressing plants were completely male sterile: the anther filaments were shorter, and the pollen grains were less abundant and shriveled. This phenotype was not observed in the previously described transgenic plants and thus seems to result directly from pma4 cosuppression in the anthers. pma4 is very active in various anther tissues, notably in the tapetum and the microspores (Moriau et al. 1999 ); therefore, it is reasonable that pma4 cosuppression in these rapidly developing sink tissues resulted in male sterility.
In conclusion, pma4 cosuppression has shed some light on the important role of this isoform in plant growth and functioning. Because pma4 is highly expressed in almost all plant organs, its cosuppression is expected to have pleiotropic effects. We have identified failures in the sugar transport, stomatal opening, and the development of male tissues. Additional effects might still be expected. Cosuppression, for instance, was also observed in root tissues, but it does not seem to affect greatly the mineral nutrition of the plant grown in soil because ions such as potassium and magnesium were not modified in the leaves of the cosuppressing plants (data not shown). The nitrogen supply also was not altered—the nitrogen content of leaves was not substantially changed. The situation might be different if these plants were grown under conditions of mineral deficit or salt stress. Further investigations would greatly benefit from tools that make it possible to address the role of PMA4 or other H+-ATPase isoforms in specific organ or cell types, by using, for example, grafting experiments or cell type–specific promoters to drive antisense constructs or cosuppression.
|
|
METHODS |
|---|
Constructs and Plant Transformation
The XhoI-HindIII fragment containing the plant plasma membrane H+-ATPase pma4 cDNA (cpma4) sequence (Luo et al. 1999 ) was cloned into pBluescript SK+ (Stratagene, La Jolla, CA). The pma4 3' AflII-HindIII fragment was replaced by the synthetic fragment 5'-ATCCTTAAGTGAGCAAAAGCTGATCAGTGAGGAAGACTTGTAATGAAGCTTCG, which encodes a c-myc 10–amino acid epitope (Kolodziej and Young 1991 ), resulting in the deletion of the last 103 C-terminal PMA4 residues. c-myc has been shown to be a convenient marker for plant H+-ATPase (DeWitt and Sussman 1995 ) but was not used in the experiments reported in this study. The BamHI-blunted XhoI fragment, containing the pma4 promoter reinforced with the cauliflower mosaic virus (CaMV) 35S enhancer introduced at position -500 upstream of the transcription start site (Zhao et al. 1999 ), was inserted into pBI101 (Jefferson et al. 1987 ) between BamHI and SmaI. After ligation, the XhoI site was recovered. Intact cpma4 and 3'-deleted cpma4 were digested by HindIII (filled in by using the Klenow fragment of DNA polymerase) and XhoI. The XhoI-blunted HindIII fragments were then cloned into XhoI and blunted SacI sites that are downstream of the activated pma4 promoter in pBI101, resulting in 500pma4 and 500pma4, respectively. The activated pma4 promoter in 500pma4 was replaced by the native pma4 from pPRP4XB (Zhao et al. 1999 ) by using BamHI and XhoI; this generated P4pma4.
Nicotiana tabacum cv SR1 was transformed as described by An et al. 1988 . The regenerated kanamycin-resistant plants were transferred to the greenhouse or conditioned room (25°C during the day for 16 hr of illumination with 45 to 185 µmol m-2 sec-1 and 20°C at night).
Microsomal and Plasma Membrane Fraction Preparation
Fresh leaf tissues (2 g) were homogenized at 2°C in a Waring blender with 10 mL of homogenization buffer (50 mM Tris-HCl, pH 8.0, 250 mM sorbitol, 2 mM EDTA, 0.7% polyvinylpyrrolidone [Polyclar T; Serva, Boehringer Ingelheim Bioproducts, Heldelberg, Germany], 5 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 0.1 µg mL-1 leupeptin, and 1 µg mL-1 each pepstatin, chymostatin, antipain, and aprotinin), and filtered through two layers of Miracloth (Calbiochem, La Jolla, CA). Aliquots (2 mL) of the homogenate were centrifuged twice at 10,000g for 5 min, after which the supernatant was centrifuged at 20,800g for 60 min. The pellet was suspended in 50 µL of 10 mM Tris-Mes, pH 6.8, and 330 mM sucrose. For minipreparations of a microsomal fraction, fresh leaf tissues (50 mg in 1.2 mL of homogenization buffer) were homogenized in a 1.5-mL Eppendorf tube by using a pestle and centrifuged as described earlier. Plasma membranes were prepared by phase partition (Larsson et al. 1987 ). Protein concentrations were measured as described by Bradford 1976 .
Immunodetection
Microsomal proteins (5 µg) were electrophoresed using SDS-PAGE, transferred to Immobilon-P (polyvinylidene difluoride membrane; Millipore, Bedford, MA), incubated with rabbit antiserum raised against PMA4 or PMA1 to PMA3 (Moriau et al. 1999 ), and revealed by chemiluminescence.
ATPase Assays
ATPase assays (Goffeau and Dufour 1988 ) were performed at 30°C for 10 min in 50 µL of medium containing 4 mM MgATP, 1 mM free Mg2+ (MgCl2), 50 mM Mes-NaOH, pH 6.8, 10 mM NaN3, 20 mM KNO3, 0.2 mM sodium molybdate, and 5 µg of proteins.
Carbohydrate and Nitrogen Analyses
Fresh leaf tissues (1 g) were frozen in liquid nitrogen, ground to a fine powder, and then extracted three times with 8 mL of 80% ethanol. After centrifugation (9500g for 10 min), the supernatants were pooled and filtered through a 0.45-µm pore-size filter to obtain the total soluble sugar extract. Starch was then extracted from the pellet with perchloric acid, as described by McCready et al. 1950 . Total soluble sugars and starch were determined by using the anthrone reagent, as described by Yemm and Willis 1954 and McCready et al. 1950 , respectively.
To measure sucrose, glucose, and fructose in the soluble sugar extract, we dried and then dissolved the samples in demineralized H2O at one-thirtieth of the initial volume. Sucrose, glucose, and fructose were measured using HPLC with a Bio-Rad Aminex HPX-87C column (300 x 7.8 mm [i.d.]), as described by Houssa et al. 1991 . Nitrogen content was determined by the Kjeldahl method.
Sugar Analysis of Leaf Exudate
Phloem exudate was collected using the EDTA method (King and Zeevaart 1974 ). Fully expanded leaves (after 4 hr of illumination) were cut at the base of the petioles. The tip of the petiole was again cut under water and then immediately immersed in 20 mM EDTA, pH 7.0, after which the leaves were placed in the dark for 8 hr in a sealed bag to prevent transpiration. The sugars in the EDTA solution were measured using HPLC, as previously described, and were expressed as micromoles of sucrose per gram (fresh weight) of leaves.
Invertase Assays
The extraction of invertase from leaves was performed as described by Tang et al. 1996 . Briefly, a leaf disc (50 mg) was homogenized in 1 mL of homogenization buffer (50 mM Hepes-KOH, pH 7.5, 1 mM EDTA, 1 mM EGTA, 2 mM benzamidine, 5 mM DTT, and 0.1 mM phenylmethylsufonyl fluoride) in an Eppendorf tube by using a pestle. The homogenate was centrifuged for 30 min at 20,800g, and the supernatant was collected for assay of alkaline invertase and soluble acid invertase. To assay cell wall–bound invertase, the pellet was washed four times with demineralized H2O and then incubated overnight in 1 mL of homogenization buffer containing 1 M NaCl. The released invertase was recovered by centrifugation.
Soluble and cell wall–bound acid invertase activity was assayed at 37°C in 250 mM sodium acetate, pH 5.5, and 100 mM sucrose. Alkaline invertase was assayed at 37°C in 27 mM Hepes-KOH, pH 7.5, and 100 mM sucrose. 3,5-Dinitrosalicylic acid reagent was added to reaction samples at 0, 30, 60, and 90 min to terminate the reaction; the glucose concentration was then determined as described by Arnold 1965 .
Stomatal Opening Assay and Measurement of Photosynthesis
The lower epidermis of developing or fully expanded leaves from 2-month-old plants was peeled off, washed by sonication (Poffenroth et al. 1992 ), and incubated for 5 hr in the dark in a solution containing 10 mM Mes-KOH, pH 6.1, 30 mM KCl, and 0.1 mM CaCl2. Fusicoccin (final concentration of 10 µM) was then added, and incubation was continued for an additional 5 hr. Stomatal apertures were measured with an optical microscope. To test the viability of the guard cells, we added 0.05% fluorescein diacetate (Sigma) and observed guard cells with a fluorescence microscope. The net photosynthetic rate of the fully expanded leaves was measured by infrared gas analysis with a portable analyzer (model LCA2; Analytical Development, Hoddeston, UK) under growth conditions.
|
|
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the Belgian National Fund for Scientific Research, the European Commission (BIOTECH program), and the Interuniversity Poles of Attraction program of the Belgian Government Office for Scientific, Technical, and Cultural Affairs. We thank Pierre Gosselin and Anne-Marie Faber for their excellent technical help.
Received December 27, 1999; accepted February 18, 2000.
|
|
REFERENCES |
|---|
An, G., Ebert, P.R., Mitra, A., and Ha, S.B. (1988) Binary vectors. In Gelvin S.B., Schilperoort R.A., Verma D.P.S., eds. Plant Molecular Biology Manual. Dordrecht, The Netherlands, Kluwer Academic Publishers. A3/1–A3/19.pp.
Arnold, W.N. (1965) ß-Fructofuranosidase from grape berries. Biochim. Biophys. Acta 110:134-147[Medline].
Bernier, G., Havelange, A., Houssa, C., Petitjean, A., and Lejeune, P. (1993) Physiological signals that induce flowering. Plant Cell 5:1147-1155[Free Full Text].
Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[CrossRef][Web of Science][Medline].
Bürkle, L., Hibberd, J.M., Quick, W.P., Kühn, C., Hirner, B., and Frommer, W.B. (1998) The H+-sucrose cotransporter NtSUT1 is essential for sugar export from tobacco leaves. Plant Physiol. 118:59-68[Abstract/Free Full Text].
De Boer, B. (1997) Fusicoccin—A key to multiple 14-3-3 locks? Trends Plant Sci. 2:60-66.
de Carvalho Niebel, F., Frendo, P., Van Montagu, M., and Cornelissen, M. (1995) Post-transcriptional cosuppression of ß-1,3-glucanase genes does not affect accumulation of transgene nuclear mRNA. Plant Cell 7:347-358[Abstract].
DeWitt, N.D., and Sussman, M.R. (1995) Immunocytological localization of an epitope-tagged plasma membrane proton pump (H+-ATPase) in phloem companion cells. Plant Cell 7:2053-2067[Abstract].
DeWitt, N.D., Harper, J.F., and Sussman, M.R. (1991) Evidence for a plasma membrane proton pump in phloem cells of higher plants. Plant J. 1:121-128[CrossRef][Web of Science][Medline].
Dorlhac de Borne, F., Vincentz, M., Chupeau, Y., and Vaucheret, H. (1994) Co-suppression of nitrate reductase host genes and transgenes in transgenic tobacco plants. Mol. Gen. Genet. 243:613-621[Web of Science][Medline].
Ewing, N.N., and Bennett, A.B. (1994) Assessment of the number and expression of P-type H+-ATPase genes in tomato. Plant Physiol. 106:547-557[Abstract].
Fang, R.X., Nagy, F., Sivasubramaniam, S., and Chua, N.-H. (1989) Multiple cis regulatory elements for maximal expression of the cauliflower mosaic virus 35S promoter in transgenic plants. Plant Cell 1:141-150[Abstract/Free Full Text].
Gahrtz, M., Stolz, J., and Sauer, N.A. (1994) Phloem-specific sucrose-H+ symporter from Plantago major L. supports the model of apoplastic phloem loading. Plant J. 6:697-706[CrossRef][Web of Science][Medline].
Geigenberger, P., Lerchl, J., Stitt, M., and Sonnewald, U. (1996) Phloem-specific expression of pyrophosphatase inhibits long distance transport of carbohydrates and amino acids in tobacco plants. Plant Cell Environ. 19:43-55[CrossRef].
Goffeau, A., and Dufour, J.P. (1988) Plasma membrane ATPase from the yeast Saccharomyces cerevisiae.. Methods Enzymol. 157:528-533[Web of Science][Medline].
Harper, J.F., Manney, L., and Sussman, M.R. (1994) The plasma membrane H+-ATPase gene family in Arabidopsis: Genomic sequence of AHA10 which is expressed primarily in developing seeds. Mol. Gen. Genet. 244:572-587[Web of Science][Medline].
Hart, C.M., Fischer, B., Neuhaus, J.M., and Meins, F., Jr. (1992) Regulated inactivation of homologous gene expression in transgenic Nicotiana sylvestris plants containing a defense-related tobacco chitinase gene. Mol. Gen. Genet. 235:179-188[CrossRef][Web of Science][Medline].
Houssa, P., Bernier, G., and Kinet, J.M. (1991) Qualitative and quantitative analysis of carbohydrates in leaf exudate of the short-day plant, Xanthium strumarium L. during floral transition. J. Plant Physiol. 138:24-28.
Huber, S.C. (1989) Biochemical mechanism for regulation of sucrose accumulation in leaves during photosynthesis. Plant Physiol. 91:656-662[Abstract/Free Full Text].
Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987) GUS fusions: ß-Glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6:3901-3907[Web of Science][Medline].
King, R.W., and Zeevaart, J.A.D. (1974) Enhancement of phloem exudation from cut petioles by chelating agents. Plant Physiol. 53:96-103[Abstract/Free Full Text].
Kolodziej, P.A., and Young, R.A. (1991) Epitope tagging and protein surveillance. Methods Enzymol. 194:508-519[Web of Science][Medline].
Kühn, C., Quick, W.P., Schulz, A., Riesmeier, J.W., Sonnewald, U., and Frommer, W.B. (1996) Companion cell–specific inhibition of the potato sucrose transporter SUT1. Plant Cell Environ. 19:1115-1123[CrossRef].
Kühn, C., Franceschi, V.R., Schulz, A., Lemoine, R., and Frommer, W.B. (1997) Macromolecular trafficking indicated by localization and turnover of sucrose transporters in enucleate sieve elements. Science 275:1298-1300[Abstract/Free Full Text].
Larsson, C., Widell, S., and Kjellborn, P. (1987) Preparation of high-purity plasma membranes. Methods Enzymol. 148:558-568[CrossRef][Web of Science].
Lerchl, J., Geigenberger, P., Stitt, M., and Sonnewald, U. (1995) Impaired photoassimilate partitioning caused by phloem-specific removal of pyrophosphate can be complemented by a phloem-specific cytosolic yeast-derived invertase in transgenic plants. Plant Cell 7:259-270[Abstract].
Lu, P., Outlaw, W.H., Jr., Smith, B.G., and Freed, G.A. (1997) A new mechanism for the regulation of stomatal aperture size in intact leaves. Plant Physiol. 114:109-118[Abstract].
Luo, H., Morsomme, P., and Boutry, M. (1999) The two major types of plant plasma membrane H+-ATPases show different enzymatic properties and confer differential pH sensitivity of yeast growth. Plant Physiol. 119:627-634[Abstract/Free Full Text].
Marrè, E. (1979) Fusicoccin, a tool in plant physiology. Annu. Rev. Plant Physiol. 30:273-288[Web of Science].
McCready, R.M., Guggolz, J., Silviera, V., and Owens, H.S. (1950) Determination of starch and amylose in vegetables: Application to peas. Anal. Chem. 22:1156-1158[CrossRef].
Michelet, B., and Boutry, M. (1995) The plasma membrane H+-ATPase: A highly regulated enzyme with multiple physiological functions. Plant Physiol. 108:1-6[Web of Science][Medline].
Michelet, B., Lukaszewicz, M., Dupriez, V., and Boutry, M. (1994) A plant plasma membrane proton-ATPase gene is regulated by development and environment and shows signs of a translational regulation. Plant Cell 6:1375-1389[Abstract].
Moriau, L., Michelet, B., Bogaerts, P., Lambert, L., Michel, A., Oufattole, M., and Boutry, M. (1999) Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme. Plant J. 19:31-41[CrossRef][Web of Science][Medline].
Oufattole, M., Arango, M., and Boutry, M. (2000) Identification and expression analysis of three new Nicotiana plumbaginifolia genes which encode isoforms of a plasma membrane H+-ATPase and one of which is induced by mechanical stress. Planta 210:715-722[CrossRef][Web of Science][Medline].
Palmgren, M.G. (1998) Proton gradients and plant growth: Role of the plasma membrane H+-ATPase. Adv. Bot. Res. 28:1-70.
Palmgren, M.G., and Christensen, G. (1994) Functional comparisons between plant plasma membrane H+-ATPase isoforms expressed in yeast. J. Biol. Chem. 269:3027-3033[Abstract/Free Full Text].
Palmgren, M.G., Sommarin, M., Serrano, R., and Larsson, C. (1991) Identification of an autoinhibitory domain in the C-terminal region of the plant plasma membrane H+-ATPase. J. Biol. Chem. 266:20470-20475[Abstract/Free Full Text].
Perez, C., Michelet, B., Ferrant, V., Bogaerts, P., and Boutry, M. (1992) Differential expression within a three-gene subfamily encoding a plasma membrane H+-ATPase in Nicotiana plumbaginifolia. J. Biol. Chem. 267:1204-1211[Abstract/Free Full Text].
Poffenroth, M., Green, D.B., and Tallman, G. (1992) Sugar concentrations in guard cells of Vicia faba illuminated with red or blue light. Plant Physiol. 98:1460-1471[Abstract/Free Full Text].
Riesmeier, J.W., Hirner, B., and Frommer, W.B. (1993) Expression of the sucrose transporter from potato correlates with the sink–source transition in leaves. Plant Cell 5:1591-1598[Abstract].
Riesmeier, J.W., Willmitzer, L., and Frommer, W.B. (1994) Evidence for an essential role of the sucrose transporter in phloem loading and assimilate partitioning. EMBO J. 13:1-7[Web of Science][Medline].
Rotman, B., and Papermaster, J. (1966) Membrane properties of living mammalian cells as studied by enzymatic hydrolysis of fluorogenic esters. Proc. Natl. Acad. Sci. USA 55:134-141[Free Full Text].
Sauer, N., and Stolz, J. (1994) SUC1 and SUC2: Two sucrose transporters from Arabidopsis thaliana: Expression and characterization in baker's yeast and identification of the histidine-tagged protein. Plant J. 6:67-77[CrossRef][Web of Science][Medline].
Serrano, R. (1989) Structure and function of plasma membrane ATPase. Annu. Rev. Plant Physiol. Plant Mol. Biol. 40:61-94[CrossRef][Web of Science].
Sonnewald, U., Brauer, M., von Schaewen, A., Stitt, M., and Willmitzer, L. (1991) Transgenic tobacco plants expressing yeast-derived invertase in either the cytosol, vacuole or apoplast: A powerful tool for studying sucrose metabolism and sink/source interactions. Plant J. 1:95-106[CrossRef][Web of Science][Medline].
Sussman, M.R. (1994) Molecular analysis of proteins in plant plasma membrane. Annu. Rev. Plant Physiol. Plant Mol. Biol. 45:211-234[CrossRef][Web of Science].
Tang, X., Ruffner, H.P., Scholes, J.D., and Rolfe, S.A. (1996) Purification and characterisation of soluble invertases from leaves of Arabidopsis thaliana. Planta 198:17-23[Web of Science][Medline].
von Schaewen, A., Stitt, M., Schmidt, R., Sonnewald, U., and Willmitzer, L. (1990) Expression of a yeast-derived invertase in the cell wall of tobacco and Arabidopsis plants leads to accumulation of carbohydrate and inhibition of photosynthesis and strongly influences growth and phenotype of transgenic tobacco plants. EMBO J. 9:3033-3044[Web of Science][Medline].
Ward, J.M., Kühn, C., Tegeder, M., and Frommer, W.B. (1998) Sucrose transport in higher plants. Int. Rev. Cytol. 178:41-71[Web of Science][Medline].
Widholm, J.M. (1972) The use of fluorescein diacetate and phenosafranine for determining the viability of cultured plant cells. Stain Technol. 47:189-194[Web of Science][Medline].
Yemm, E.W., and Willis, A.J. (1954) The estimation of carbohydrates in plant extracts by anthrone. Biochem. J. 57:508-514[Web of Science][Medline].
Young, J.C., DeWitt, N.D., and Sussman, M.R.A. (1998) A transgene encoding a plasma membrane H+-ATPase that confers acid resistance in Arabidopsis thaliana seedlings. Genetics 149:501-507[Abstract/Free Full Text].
Zhao, R., Moriau, L., and Boutry, M. (1999) Expression analysis of the plasma membrane H+-ATPase pma4 transcription promoter from Nicotiana plumbaginifolia activated by the CaMV 35S promoter enhancer. Plant Sci. 149:157-165[CrossRef].
TOP
ABSTRACT
INTRODUCTION
