|
|
||||||||
|
First published online April 29, 2002; 10.1105/tpc.001727 American Society of Plant Biologists Efficient Repair of Genomic Double-Strand Breaks by Homologous Recombination between Directly Repeated Sequences in the Plant GenomeInstitut für Pflanzengenetik und Kulturpflanzenforschung, Corrensstrasse 3, D-06466 Gatersleben, Germany 1 To whom correspondence should be addressed. E-mail puchta{at}ipk-gatersleben.de; fax 49-39482-5137
Previous studies demonstrated that in somatic plant cells, homologous recombination (HR) is several orders of magnitude less efficient than nonhomologous end joining and that HR is little used for genomic double-strand break (DSB) repair. Here, we provide evidence that if genomic DSBs are induced in close proximity to homologous repeats, they can be repaired in up to one-third of cases by HR in transgenic tobacco. Our findings are relevant for the evolution of plant genomes because they indicate that sequences containing direct repeats such as retroelements might be less stable in plants that harbor active mobile elements than anticipated previously. Furthermore, our experimental setup enabled us to demonstrate that transgenic sequences flanked by sites of a rare cutting restriction enzyme can be excised efficiently from the genome of a higher eukaryote by HR as well as by nonhomologous end joining. This makes DSB-induced recombination an attractive alternative to the currently applied sequence-specific recombination systems used for genome manipulations, such as marker gene excision.
Until now, it was generally accepted that homologous recombination (HR) is a minor recombination pathway in somatic plant cells under all circumstances. It has been reported that HR proceeds at frequencies that are several orders of magnitude lower than nonhomologous end joining (NHEJ) (for reviews, see Puchta and Hohn, 1996
Rare cutting restriction enzymes or transposable elements have been used to induce a double-strand break (DSB) at a specific location in the plant genome and to study its repair (for review, see Gorbunova and Levy, 1999
To reevaluate the role of HR in DSB repair between closely linked sequences in plants, we set up an assay system in tobacco based on interrupted overlapping halves of a
Experimental Setup and Induction of Recombination The binary vector pGU.C.USB was constructed for the analysis of the efficiency of homologous DSB repair in the presence of nearby homology (for details, see Methods and Figure 1) . A negative selectable marker gene (cytosine deaminase; codA [Stougaard, 1993
Tobacco seedlings were transformed by Agrobacterium tumefaciens with the binary vector pGU.C.USB. Plants were regenerated, and lines carrying the transgenic sequences at a single locus were identified by segregation analysis and characterized by DNA gel blot analysis. Three lines were chosen for further analysis: GU.C.USB 1, containing a single copy of the transgene, and GU.C.USB 3 and 7, containing two closely linked copies of the transgene. Detailed restriction analysis indicated that in both lines the copies were not joined directly in tandem to one another but were separated by nontransgenic sequences of at least several kilobases. The lines with the two copies were chosen to test whether individual DSB repair events at a transgenic locus might influence each other, as has been reported previously for intrachromosomal recombination in tobacco (Peterhans et al., 1990
Seedlings of the F1 generation of all three lines were inoculated with an Agrobacterium strain that harbored on its T-DNA an I-SceI open reading frame under the control of the 35S promoter of Cauliflower mosaic virus to achieve transient expression of the enzyme (Puchta, 1999b
Molecular Analysis of the Recombination Products of Line GU.C.USB 1 The calli were analyzed further depending on the number of transgene copies in the original lines. Polymerase chain reaction (PCR) analysis was performed on a large number of calli from the single-copy line GU.C.USB 1. For amplification, oligonucleotides were designed that allowed the amplification of a 0.7-kb fragment if the GUS gene was restored by HR. A 1.4-kb fragment was indicative of a NHEJ event between the genomic ends of the two I-SceI sites (Figure 1). The results of this analysis are shown in Table 2. Three different classes of events could be distinguished: events resulting in a 0.7-kb band, events resulting in a 1.4-kb band, and events yielding no amplification product.
The 0.7-kb band is indicative of a HR reaction within the GUS gene, resulting in the restoration of the marker. This was proven further by the fact that the tested calli containing this band turned blue after histochemical staining with 5-bromo-4-chloro-3-indolyl- -D-glucuronide. Three 0.7-kb bands were sequenced, and the normal sequence of the GUS gene was detected, as expected for a HR event between the overlaps. DNA gel blot analysis of representative lines confirmed the PCR results. To discriminate unambiguously between HR and NHEJ, a digest with Acc65I was especially useful, because the indicative bands could be discriminated easily by size: a 4.4-kb band indicated NHEJ, and a 3.7-kb band indicated HR (Figure 1). As shown for the representative line GU.C.USB 1-83, the expected 3.7-kb band was detected with a GUS-specific probe (Figure 3C
, lane 3). The codA-specific sequences were removed completely (disappearance of the transgene-specific bands in lane 3 of Figures 3A and 3C after rehybridization of the blot with a codA-specific probe, lane 3 of Figures 3B and 3D).
Because the 1.4-kb band originated from a NHEJ process, we expected that individual products would differ in their sequences at the rejoined break sites, as has been shown previously (Gorbunova and Levy, 1997
Molecular Analysis of the Recombination Products of Lines GU.C.USB 3 and 7 After elimination of the codA expression cassette by NHEJ reaction between the two I-SceI sites, the HindIII fragment should be reduced by 2.8 kb. If the codA gene is eliminated by HR, the fragment should be smaller by another 0.7 kb (the length of the overlapping region). In Figure 3A (which shows a DNA gel blot of HindIII-restricted DNA hybridized with a GUS-specific probe), the changes in size of each of the two individual transgene copies are documented for representative recombinant lines of GU.C.USB 3 and 7 (Figure 3A, lanes 5 and 8 [NHEJ of lines GU.C.USB 3-1 and GU.C.USB 7-14] and lanes 6 and 9 [HR of lines GU.C.USB 3-3 and GU.C.USB 7-34]). The absence of any transgene-specific signal on the blot probed with codA indicates that the codA expression cassette was eliminated, as predicted in all cases from both copies (Figure 3B, lanes 5, 6, 8, and 9). Because lines GU.C.USB 3 and 7 harbor two transgene copies, probing of Acc65I-restricted DNA with a GUS-specific probe was especially informative for the discrimination of HR and NHEJ events. The simultaneous presence of a 4.4-kb band and a 3.7-kb band indicated the repair of one copy by HR and the other by NHEJ, whereas the appearance of only a 4.4-kb band indicated the repair of both copies by NHEJ and the appearance of only a 3.7-kb band indicated the repair of both copies by HR. A number of transgenic lines were analyzed this way, and the results are shown in Table 3. Surprisingly, we were unable to detect cells harboring both fragments. If one copy recombined by HR, the second copy was coconverted (Figure 3C, lanes 6 and 9). We amplified 0.7-kb bands by PCR in cases in which the DNA gel blots indicated that HR occurred. As expected, the sequence analysis of four PCR products (two for each line) revealed the functional GUS sequence resulting from a HR event between the overlaps within pGU.C.USB. DNA gel blot analysis also clearly demonstrated that the recombination reactions occurred within the transgene copies and not between them, resulting in a loss of intervening sequences. In the latter case, a single GUS-specific HindIII fragment would have been visible after recombination on the DNA gel blot. However, in all lines tested in this study, two GUS-specific HindIII fragments were clearly visible after the recombination reaction (Figure 3A). Compared with the parent lines, both fragments were reduced by the same size, as expected from intratransgenic recombination events.
The third class of recombination events harbored mainly deletions within the transgene. Bands smaller than 3 kb were detected with a GUS-specific probe in several cases, indicating deletions of various sizes within the transgene locus. In two cases, further rearrangements occurred, resulting in several novel transgene-specific bands. In all cases tested, these deletions or rearrangements were accompanied by the complete loss of the codA-specific sequences (data not shown).
The Role of HR and NHEJ in Genomic DSB Repair in Plants DSBs are critical lesions in genomes. Therefore, efficient repair of DSBs is important for the survival of all organisms. In principle, DSBs can be repaired by illegitimate recombination or by HR. A major goal of recent studies was to elucidate under which conditions each pathway is used preferentially. For this purpose, rare cutting restriction endonucleases were applied for the induction of breaks at defined loci within eukaryotic genomes (for review, see Paques and Haber, 1999 Because we could not measure the relation between HR and NHEJ in planta directly, we devised an experimental system in which, after the excision of a negative selectable marker gene, a single genomic DSB had to be repaired. Because the marker gene was lost, all resulting repair events (independent of their nature) could be selected for. Important for the evaluation of the results was that both I-SceI sites were cut simultaneously by the transiently expressed restriction enzyme. If in most cases only one site were cut, the single DSB itself could induce the elimination of the codA gene by HR, resulting in a biased picture and thus an overestimation of the frequency of HR events.
In previous experiments conducted in tobacco, we demonstrated that the induction of a DSB within the codA gene leads to the production of a large number of deletions of various sizes that still contained nonfunctional parts of the codA gene (Salomon and Puchta, 1998
Efficient Repair of Genomic DSBs by Single-Strand Annealing of Homologous Sequences
The synthesis-dependent strand-annealing model describes the directed transfer of information from a homologous donor sequence to the break site. This process does not result in the loss of genomic sequences because the donor locus is conserved. This is in contrast to the experimental situation applied in the present study. Recombination between direct repeated sequences is described best by the single-strand annealing (SSA) model of recombination. The SSA model was suggested first for extrachromosomal recombination between plasmids in mammalian cells (Lin et al., 1984
This model has been used to describe extrachromosomal recombination in Xenopus laevis oocytes (Maryon and Carroll, 1991a
We are convinced that the repair of genomic DSBs using directly repeated sequences is an efficient pathway in eukaryotes in general and not a phenomenon restricted to plants or even tobacco. This hypothesis is sustained by two recent studies in mammalian cells (Liang et al., 1998
Using lines that harbor two copies of the T-DNA, we were surprised to find in all cases that both copies were changed by HR, similar to the high coconversion frequencies reported for several copies of an intrachromosomal recombination substrate integrated at a single locus in tobacco (Peterhans et al., 1990
Consequences for Genome Evolution
If one assumes that transient breaks within the internal part of BARE-1 are induced either by the activity of transposons (Xiao et al., 2000
Biotechnological Application: Marker Gene Excision The development of alternative approaches for site-specific alterations of genomes is of great interest in biotechnology. A very promising approach would involve the combined elimination of the transgene sequences and their respective recognition sequences. Therefore, the use of a highly specific restriction endonuclease to remove transgenic sequences from the plant genome might be a useful, irreversible alternative to the established site-specific techniques. In the current study, we demonstrated that a marker gene can be eliminated efficiently from the plant genome by either HR or NHEJ (including religation) by inducing DSBs with a rare cutting restriction enzyme. Thus, any sequence flanked by restriction sites could be eliminated from genomes of plants and probably also from other eukaryotic organisms. The sequence in our case was the codA gene, which was used simultaneously as a negative selectable marker. In practice, other sequences to be removed also could be included adjacent to this marker. For example, a selectable marker gene could be included in the I-SceI cassette of the transgene. Other rare cutting endonucleases also might be useful for this purpose. PCR analysis of resistant calli in the single-copy line GU.C.USB 1 showed precise excision of the marker gene in more than two-thirds of the cases (in 22 of 29 calli). Taking all isolated recombination events of lines GU.C.USB 1, 3, and 7 into account (Table 1), we obtained 57 homologous recombinants in 205 5-FCresistant calli (>27%) and conclude that almost every third excision event of the marker is attributable to HR.
Our findings also might help explain recent results on the HR-mediated elimination of a selectable marker gene from the tobacco genome (Zubko et al., 2000
By means of controlled induction of DSBs by a restriction endonuclease, we now demonstrate that even higher frequencies of HR can be obtained in all of our lines. The obvious advantage of the controlled induction of DSBs is that the marker gene is removed efficiently independent of its location in the genome. No indications for the instability of the transgenic loci in the absence of I-SceI expression, an important prerequisite for bringing transgenic plants into the field, were found. We were unable to isolate deletion events without DSB induction. However, we were able to determine the overall rate of spontaneous homologous recombination by performing histochemical staining of 4-week-old tobacco seedlings. The obtained frequencies were 10-6 or lower (per genome; data not shown), similar to that reported in previous studies (Puchta et al., 1995a
DNA Constructs The binary plasmid pGU.US was used for construction of the recombination substrate. The plasmid contains on its T-DNA two halves of the -glucuronidase (GUS) gene with an overlap of 557 bp (Tinland et al., 1994
The oligonucleotides used in the PCR reaction were 5'-pCGGCTCTAGAGCGGCCGCCTAGGGATAACAGGGTAATAGAATCCCACAAAAATCTGAGCTTAACAG-3' and 5'-pCGGCTCTAGACTATTACCCTGTTATCCCTAGGCCCGATCTAGTAACATAGATGA-CACCGCGCGCG-3'. The PCR product carrying I-SceI sites at its ends was digested by XbaI-NotI and exchanged in pGU.US with the XbaI-NotI fragment carrying the hygromycin gene, resulting in the binary plasmid pGU.C.USB (Figure 1). In this binary plasmid, the codA gene is flanked by two I-SceI sites in direct orientation. The I-SceI expression vector pCISceI (Puchta et al., 1996
Plant Transformation
In a second series of experiments, F1 seedlings of the transgenic lines GU.C.USB 1, 3, and 7 were inoculated with an Agrobacterium strain harboring the binary plasmid pCISceI as described by Puchta (1999b)
GUS assays were performed as described by Swoboda et al. (1994)
Plant DNA Extraction and DNA Gel Blot Analysis
PCR and Sequence Analysis
We thank Charles White and Ingo Schubert for useful criticism of the manuscript and Frank Hartung, Brigit Gisler, and Fabian Heitzeberg for help and discussions. This study was funded partly by a grant from the biotechnology program of the Kultusministerium of Sachsen-Anhalt.
Article, publication date, and citation information can be found at www.plantcell.org/cgi/doi/10.1105/tpc.001727. Received January 18, 2002; accepted February 11, 2002.
Bilang, R., Peterhans, A., Bogucki, A., and Paszkowski, J. (1992). Single-stranded DNA as recombination substrate in plants assessed by stable and transient expression. Mol. Cell. Biol. 12, 329336. Chiurazzi, M., Ray, A., Viret, J.-F., Perera, R., Wang, X.-H., Lloyd, A., and Signer, E.R. (1996). Enhancement of somatic intrachromosomal homologous recombination in Arabidopsis by HO-endonuclease. Plant Cell 8, 20572066.[Abstract]
De Groot, M.J.A., Offringa, R., Does, M.P., Hooykaas, P.J.J., and van den Elzen, P.J.M. (1992). Mechanisms of intermolecular homologous recombination in plants as studied with single- and double-stranded DNA molecules. Nucleic Acids Res. 20, 27852794.
Fishman-Lobell, J., Rudin, N., and Haber, J.E. (1992). Two alternative pathways of double-strand break repair that are kinetically separable and independently modulated. Mol. Cell. Biol. 12, 12921303. Gallego, M.E., Sirand-Pugnet, P., and White, C.I. (1999). Positive-negative selection and T-DNA stability in Arabidopsis transformation. Plant Mol. Biol. 39, 8393.[CrossRef][Web of Science][Medline]
Gorbunova, V., and Levy, A.A. (1997). Non-homologous DNA end joining in plant cells is associated with deletions and filler DNA insertions. Nucleic Acids Res. 25, 46504657. Gorbunova, V., and Levy, A.A. (1999). How plants make ends meet: DNA double-strand break repair. Trends Plant Sci. 4, 263269.[CrossRef][Web of Science][Medline]
Hartung, F., and Puchta, H. (2000). Molecular characterization of two paralogous SPO11 homologues in Arabidopsis thaliana. Nucleic Acids Res. 28, 15481554. Hohn, B., Levy, A., and Puchta, H. (2001). Elimination of selection markers from transgenic plants. Curr. Opin. Biotechnol. 12, 139143.[CrossRef][Web of Science][Medline] Jasin, M. (2000). Chromosome breaks and genomic instability. Cancer Invest. 18, 7886.[Web of Science][Medline]
Kalendar, R., Tanskanen, J., Immonen, S., Nevo, E., and Schulman, A.H. (2000). Genome evolution of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon dynamics in response to sharp microclimatic divergence. Proc. Natl. Acad. Sci. USA 97, 66036607. Kirik, A., Salomon, S., and Puchta, H. (2000). Species-specific double-strand break repair and genome evolution in plants. EMBO J. 19, 55625566.[CrossRef][Web of Science][Medline] Kovalchuk, I., Kovalchuk, O., Arkhipov, A., and Hohn, B. (1998). Transgenic plants are sensitive bioindicators of nuclear pollution caused by the Chernobyl accident. Nat. Biotechnol. 11, 10541059.[CrossRef]
Lebel, E.G., Masson, J., Bogucki, A., and Paszkowski, J. (1993). Stress-induced intrachromosomal recombination in plant somatic cells. Proc. Natl. Acad. Sci. USA 90, 422426.
Lehman, C.W., Trautman, J.K., and Carroll, D. (1994). Illegitimate recombination in Xenopus: Characterization of end-joined junctions. Nucleic Acids Res. 22, 434442.
Liang, F., Han, M., Romanienko, P.J., and Jasin, M. (1998). Homology-directed repair is a major double-strand break repair pathway in mammalian cells. Proc. Natl. Acad. Sci. USA 95, 51725177.
Lin, F.-L., Sperle, K., and Sternberg, N. (1984). Model for homologous recombination during transfer of DNA into mouse L cells: Role for DNA ends in the recombination process. Mol. Cell. Biol. 4, 10201034.
Lin, F.-L., Sperle, K., and Sternberg, N. (1990). Intermolecular recombination between DNAs introduced into mouse L cells is mediated by a nonconservative pathway that leads to crossover products. Mol. Cell. Biol. 10, 103112.
Maryon, E., and Carroll, D. (1991a). Involvement of single-stranded tails in homologous recombination of DNA injected into Xenopus laevis oocyte nuclei. Mol. Cell. Biol. 11, 32683277.
Maryon, E., and Carroll, D. (1991b). Characterization of recombination intermediates from DNA injected into Xenopus laevis oocytes: Evidence for a nonconservative mechanism of homologous recombination. Mol. Cell. Biol. 11, 32783287.
Mason, R.M., Thacker, J., and Fairman, M.P. (1996). The joining of non-complementary DNA double-strand breaks by mammalian extracts. Nucleic Acids Res. 24, 49464953. Mengiste, T., Revenkova, E., Bechtold, N., and Paszkowski, J. (1999). An SMC-like protein is required for efficient homologous recombination in Arabidopsis. EMBO J. 18, 45054512.[CrossRef][Web of Science][Medline] Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol. Plant. 15, 473497.[CrossRef]
Nicolas, A.L., Munz, P.L., and Young, C.S. (1995). A modified single-strand annealing model best explains the joining of DNA double-strand breaks in mammalian cells and cell extracts. Nucleic Acids Res. 23, 10361043. Ow, D. (2002). Recombination-directed plant transformation for the post-genomic era. Plant Mol. Biol. 48, 183200.[CrossRef][Web of Science][Medline]
Paques, F., and Haber, J.E. (1999). Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63, 349404. Peterhans, A., Schlüpmann, H., Basse, C., and Paszkowski, J. (1990). Intrachromosomal recombination in plants. EMBO J. 9, 34373445.[Web of Science][Medline] Pipiras, E., Coquelle, A., Bieth, A., and Debatisse, M. (1998). Interstitial deletions and intrachromosomal amplification initiated from a double-strand break targeted to a mammalian chromosome. EMBO J. 17, 325333.[CrossRef][Web of Science][Medline] Puchta, H. (1998a). Repair of genomic double-strand breaks in somatic plant cells by one-sided invasion of homologous sequences. Plant J. 13, 331339.[CrossRef][Web of Science] Puchta, H. (1998b). Towards targeted transformation in plants. Trends Plant Sci. 3, 7778.[Web of Science]
Puchta, H. (1999a). DSB-induced recombination between ectopic homologous sequences in somatic plant cells. Genetics 152, 11731181. Puchta, H. (1999b). Use of I-SceI to induce double-strand breaks in Nicotiana. Methods Mol. Biol. 113, 447451.[Medline] Puchta, H. (2000). Removing selectable marker genes: Taking the shortcut. Trends Plant Sci. 5, 273274.[CrossRef][Web of Science][Medline] Puchta, H. (2002). Gene replacement by homologous recombination in plants. Plant Mol. Biol. 48, 173182.[CrossRef][Web of Science][Medline] Puchta, H., and Hohn, B. (1991). The mechanism of extrachromosomal homologous DNA recombination in plant cells. Mol. Gen. Genet. 230, 17.[CrossRef][Medline] Puchta, H., and Hohn, B. (1996). From centimorgans to basepairs: Homologous recombination in plants. Trends Plant Sci. 1, 340348.[CrossRef] Puchta, H., and Meyer, P. (1994). Substrate specificity of plant recombinases determined in extrachromosomal recombination systems. In Homologous Recombination and Gene Silencing in Plants, J. Paszkowski, ed (Dordrecht, The Netherlands: Kluwer Academic Publishers), pp. 123155.
Puchta, H., Dujon, B., and Hohn, B. (1993). Homologous recombination in plant cells is enhanced by in vivo induction of double-strand breaks into DNA by a site-specific endonuclease. Nucleic Acids Res. 21, 50345040. Puchta, H., Swoboda, P., and Hohn, B. (1995a). Induction of intrachromosomal homologous recombination in whole plants. Plant J. 7, 203210.[CrossRef][Web of Science] Puchta, H., Swoboda, P., Gal, S., Blot, M., and Hohn, B. (1995b). Intrachromosomal homologous recombination events in populations of plant siblings. Plant Mol. Biol. 28, 281292.[CrossRef][Web of Science][Medline]
Puchta, H., Dujon, B., and Hohn, B. (1996). Two different but related mechanisms are used in plants for the repair of genomic double-strand breaks by homologous recombination. Proc. Natl. Acad. Sci. USA 93, 50555060.
Reiss, B., Schubert, I., Köpchen, K., Wendeler, E., Schell, J., and Puchta, H. (2000). RecA stimulates sister chromatid exchange and the fidelity of double-strand break repair, but not gene targeting, in plants transformed by Agrobacterium. Proc. Natl. Acad. Sci. USA 97, 33583363. Ries, G., Heller, W., Puchta, H., Sandermann, H.J., Seidlitz, H.K., and Hohn, B. (2000). Elevated UV-B radiation reduces genome stability in plants. Nature 406, 98101.[CrossRef][Medline] Salomon, S., and Puchta, H. (1998). Capture of genomic and T-DNA sequences during double-strand break repair in somatic plant cells. EMBO J. 17, 60866095.[CrossRef][Web of Science][Medline]
SanMiguel, P., Tikhonov, A., Jin, Y.K., Motchoulskaia, N., Zakharov, D., Melake-Berhan, A., Springer, P.S., Edwards, K.J., Lee, M., Avramova, Z., and Bennetzen, J.L. (1996). Nested retrotransposons in the intergenic regions of the maize genome. Science 274, 765768. Shalev, G., and Levy, A.A. (1997). The maize transposable element Ac induces recombination between the donor site and an homologous ectopic sequence. Genetics 146, 11431151.[Abstract]
Shirasu, K., Schulman, A.H., Lahaye, T., and Schulze-Lefert, P. (2000). A contiguous 66-kb barley DNA sequence provides evidence for reversible genome expansion. Genome Res. 10, 908915. Stougaard, J. (1993). Substrate-dependent negative selection in plants using a bacterial cytosine deaminase gene. Plant J. 3, 755761.[CrossRef][Web of Science] Swoboda, P., Gal, S., Hohn, B., and Puchta, H. (1994). Intrachromosomal homologous recombination in whole plants. EMBO J. 13, 481489.
Tinland, B., Hohn, B., and Puchta, H. (1994). Agrobacterium tumefaciens transfers single stranded T-DNA into the plant cell nucleus. Proc. Natl. Acad. Sci. USA 91, 80008004.
Tovar, J., and Lichtenstein, C. (1992). Somatic and meiotic chromosomal recombination between inverted duplications in transgenic tobacco plants. Plant Cell 4, 319332. Vergunst, A.C., and Hooykaas, P.J.J. (1999). Recombination in the plant genome and its application in biotechnology. Crit. Rev. Plant Sci. 18, 131.
Vicient, C.M., Suoniemi, A., Anamthawat-Jonsson, K., Tanskanen, J., Beharav, A., Nevo, E., and Schulman, A.H. (1999). Retrotransposon BARE-1 and its role in genome evolution in the genus Hordeum. Plant Cell 11, 17691784.
Vicient, C.M., Jaaskelainen, M.J., Kalendar, R., and Schulman, A.H. (2001). Active retrotransposons are a common feature of grass genomes. Plant Physiol. 125, 12831292. Xiao, Y.L., and Peterson, T. (2000). Intrachromosomal homologous recombination in Arabidopsis induced by a maize transposon. Mol. Gen. Genet. 263, 2229.[CrossRef][Medline]
Xiao, Y.L., Li, X., and Peterson, T. (2000). Ac insertion site affects the frequency of transposon-induced homologous recombination at the maize p1 locus. Genetics 156, 20072017. Zubko, E., Scutt, C., and Meyer, P. (2000). Intrachromosomal recombination between attP regions as a tool to remove selectable marker genes from tobacco transgenes. Nat. Biotechnol. 18, 442445.[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | THE PLANT CELL | PLANT PHYSIOLOGY | |
|---|---|---|---|