Supplemental Data

Files in this Data Supplement:

• Supplemental Figure 1 - TIC differentially affects rhythmic markers. (A) Mathematical analysis of CAB:LUC expression data for individual seedlings (n = 20) of WT (filled squares) and tic mutant (open circles) assayed under LL, in parallel with those shown in Fig. 1A. (B) Mathematical analysis of CCR2:LUC expression data for individual seedlings (n = 19-34) of WT (filled squares) and tic mutant (open circles) assayed under constant R+B, in parallel with those shown in Fig. 1C. (C) CAB:LUC luminescence of tic;elf3-1 double mutants entrained under 16L:8D (open symbols) or 8L:16D (filled symbols). CAB:LUC luminescence was monitored under R:D cycles with the same photoperiod for 3 days before transfer to DD, as in Figs. 2A and 2B. Open bars, light interval; filled bars, dark interval. Data presented are means of luminescence from 16 individual seedling records. (D) and (E) CAB:LUC luminescence of tic;elf3-1 double mutants in DD. Data presented are relative luminescence traces from individual seedlings in one of the experiments represented by Fig. 5B, showing the variety of expression patterns in the double mutant (filled squares, crosses). These include (D) low-amplitude fluctuations with rising or falling luminescence and (E) ultradian patterns. The mean values for luminescence in elf3-1 (open triangles) and tic (solid line) seedlings are shown for comparison. Filled bar, dark interval.
• Supplemental Figure 2 - Structure and identification of lhy, cca1, and eec mutant alleles. T-DNA insertion alleles were identified by PCR amplification of pooled genomic DNAs using the following primers: CCA1F, AAAGCTGAATCATCTCTTCAGCCACTAGT; CCA1R, AGTCAAATGTTACAGGAAGACTATGGACA; LHYF, CTCTGTTTGGCTGCTGAGAAACTTATAGA; LHYR, AACCTGACATGACCAAAGAAATGTTCGGA; EECF, TGGAATAGAAGCACAAAAGTCTATCTT; EECR, ACACGCTCTCTTAACACGTCAAAAT; T-DNA primers, JL202/JL270. T-DNA location and orientation are shown relative to the open reading frame (wide bars) and introns (intervening line) of each gene.