|
|
||||||||
|
First published online August 19, 2004; 10.1105/tpc.104.022699 © 2004 American Society of Plant Biologists
Isolation and Functional Analysis of Arabidopsis Stress-Inducible NAC Transcription Factors That Bind to a Drought-Responsive cis-Element in the early responsive to dehydration stress 1 Promoter
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Plant breeding for improved stress tolerance has consistently demonstrated that plant vigor under a range of environmental conditions is governed by multiple loci. Thus, stress tolerance is an inherently multigenic trait in nature. Although the vast majority of these genes remain to be identified, some transcription factors and regulatory sequences in plant promoters have been described. In Arabidopsis thaliana, cis-elements and corresponding binding proteins, each containing a distinct type of DNA binding domain, such as AP2/ERF, basic leucine zipper, HD-ZIP, MYB, MYC, and several classes of zinc finger domains, have been implicated in plant stress responses because their expression is induced or repressed under different stress conditions (Shinozaki and Yamaguchi-Shinozaki, 2000
; Pastori and Foyer, 2002
). Altering the expression of certain transcription factors can greatly influence plant stress tolerance (Jaglo-Ottosen et al., 1998
; Liu et al., 1998
; Kasuga et al., 1999
).
There are at least four independent regulatory systems for gene expression in response to drought stress in Arabidopsis. Two are abscisic acid (ABA) dependent and two are ABA independent (Shinozaki and Yamaguchi-Shinozaki, 2000
). Dehydration-responsive element/C-repeat (DRE/CRT) has been identified as a cis-acting element involved in one of the ABA-independent regulatory systems. DRE/CRT also functions in cold- and high-salt-responsive gene expression. When the DRE/CRT binding protein DREB1/CBF was overexpressed in the transgenic Arabidopsis plants, altered expression of more than 40 stress-inducible genes was observed, leading to increase freezing, salt, and drought tolerance (Seki et al., 2001
; Fowler and Thomashow, 2002
; Maruyama et al., 2004
). Other transcriptional regulators, such as the MYC and MYB proteins, are activators in one of the ABA-dependent regulatory systems (Abe et al., 2003
). ABA-responsive element functions as a cis-acting element in the other ABA-dependent regulatory system. ABA-responsive element binding basic leucine zippertype proteins known as AREBs/ABFs have been identified as transcriptional activators in this ABA-dependent regulatory system (Choi et al., 2000
; Uno et al., 2000
).
The least understood regulatory system is the ABA-independent one, which functions in the activation of drought-inducible genes that do not respond to either cold or ABA treatment, such as erd1, which encodes a protein with homology to the ATP binding subunit of the Clp ATP-dependent protease from Escherichia coli (Kiyosue et al., 1993
; Nakashima et al., 1997
). To further dissect this ABA-independent regulatory system, much research, including promoter analysis, has been conducted on erd1, which is upregulated in response to drought, high salinity, and dark-induced senescence (Kiyosue et al., 1993
; Nakashima et al., 1997
). Recently, Simpson et al. (2003)
demonstrated that erd1 expression during dehydration depends on the integrity of both the 14-bp rps1 site 1like sequence and the putative MYC-like (CATGTG) sequence in the promoter region.
To elucidate the trans-acting factors that interact with the putative cis-acting motifs found in the erd1 promoter region, and thus further dissect the signal transduction machinery involved in the early response to dehydration in Arabidopsis, we cloned three cDNAs encoding proteins that can bind to the 63-bp fragment of the erd1 promoter from 434 to 497 containing the CATGTG motif. Sequence analyses revealed that the three newly identified proteins belong to a large multigene family of plant-specific NAC transcription factors with more than 100 members (Riechmann et al., 2000
). We analyzed the function of the three NAC proteins as trans-acting factors by transient expression in Arabidopsis T87 protoplasts. By analysis of the NAC proteins using the yeast one-hybrid protocol, we identified the complete DNA binding sequence recognized by the NAC proteins, which we named NAC recognition sequence (NACRS), and the core binding site. We studied the expression of the associated NAC genes by RNA gel blot analysis and promoterß-glucuronidase (GUS) assay. We also studied the gene expression profile of Arabidopsis transgenic plants ectopically expressing ANAC019, ANAC055, and ANAC072 using a 7000-cDNA microarray and identified several target genes of the ANAC019, ANAC055, and ANAC072 transcriptional activators. These transgenic plants showed improved drought tolerance.
| RESULTS |
|---|
|
|
|---|
|
Structural Analysis of the BD cDNAs
To study the structure of the BD1, BD2, and BD3 clones, we sequenced the inserted cDNA fragments, measuring 1.1, 1.2, and 0.9 kb, respectively. The amino acid sequence of each encoded protein was subjected to a database search. The N-terminal half of the three proteins was found to share substantial sequence similarity with all members of the NAC family of proteins (Ooka et al., 2003
). BD1, BD2, and BD3 were therefore renamed ANAC055, ANAC019, and ANAC072 according to the nomenclature established for the family of Arabidopsis NAC proteins (Ooka et al., 2003
). The MYC-like CATGTG motif was thus designated NACRS. At the nucleotide sequence level, ANAC019 has 77% sequence similarity to ANAC055 and 56% to ANAC072, and ANAC055 has 51% sequence similarity to ANAC072. The isolated cDNAs each contains a single open reading frame that encodes a novel protein of 317, 317, and 297 amino acids, respectively (Figure 2). At the amino acid level, ANAC019 has 72% sequence similarity to ANAC055 and 65% to ANAC072, and ANAC055 has 62% sequence similarity to ANAC072. The observed regions of homology among ANAC019, ANAC055, and ANAC072 were found not only in the NAC domain but also in three short regions, one a Ser-rich region and one near the C terminus (Figure 2).
|
Purified ANAC019, ANAC055, and ANAC072 Bind Specifically to the NACRS Motif
To validate the genetic data in vitro, we attempted to see whether the purified ANAC019, ANAC055, and ANAC072 proteins specifically interacted with the NACRS. To accomplish this, we used E. coli to express recombinant NACglutathione S-transferase (NAC-GST) fusion proteins, which we then purified. These proteins were incubated with both the wild-type 63-bp fragment containing the intact NACRS motif and the base-substituted 63-bp fragment in which the CATGTG motif was replaced with the sequence AAAAAA. The incubation mixtures were then analyzed by gel retardation assay. Whereas the wild-type fragment caused a distinct shift in the molecular weight of the NAC fusion proteins, the base-substituted fragment produced no such shift (Figure 3). The GST protein did not bind to either the wild-type or base-substituted 63-bp fragments (data not shown). This result demonstrates that the ANAC019, ANAC055, and ANAC072 proteins specifically bind to the 63-bp DNA fragment carrying the NACRS motif.
|
|
|
|
|
|
|
|
Arabidopsis Plants Overexpressing ANAC019, ANAC055, and ANAC072: Morphological Effects and Microarray Analysis
To analyze the function of the NAC proteins in plants, we generated transgenic plants in which the NAC protein was overexpressed (35S:ANAC019, 35S:ANAC055, and 35S:ANAC072). The ANAC019, ANAC055, and ANAC072 cDNAs were overexpressed under the control of the CaMV 35S promoter. To check the expression level of ANAC019, ANAC055, and ANAC072 in transgenic plants, total RNA prepared from 15 lines of the 35S:ANAC019 plants, 15 lines of the 35S:ANAC055 plants, and 15 lines of the 35S:ANAC072 plants was subjected to RNA gel blot analyses using ANAC019-, ANAC055-, and ANAC072-specific probes. As a control, total RNA prepared from two or three transgenic lines containing the pBI35SHyg vector was used. The results of RNA gel blot hybridization of several representative 35S:ANAC019, 35S:ANAC055, and 35S:ANAC072 transgenic lines with ANAC019, ANAC055, or ANAC072 probes are shown in Figure 11. ANAC019, ANAC055, and ANAC072 were significantly overexpressed in these transgenic lines.
|
|
7000 Arabidopsis full-length cDNAs (Seki et al., 2002a
|
|
|
| DISCUSSION |
|---|
|
|
|---|
ANAC019, ANAC055, and ANAC072 have significant sequence similarity in the NAC binding domain, which can be divided into five subdomains (A to E) according to Ooka et al. (2003)
(Figure 2). Moreover, the three proteins have conserved sequences in the C-terminal half (Figure 2), and there are acidic and Gln-rich regions in the C-terminal portion of the predicted sequences that may be involved in transcriptional activation (Künzler et al., 1994
). Furthermore, ANAC019, ANAC055, and ANAC072 might be assigned to the class of Ser-rich activation domains (Triezenberg, 1995
). However, we cannot exclude the possibility that the newly identified NAC proteins may also feature a novel activation domain. In addition, the amino acid sequences of ANAC019 and ANAC055 show greater sequence similarity to each other than either does to ANAC072. This may further explain why ANAC072 was active as a transcriptional activator only in Arabidopsis, whereas ANAC019 and ANAC055 were functionally active in both Arabidopsis and yeast.
The NAC proteins bound specifically to the NACRS, which contains the CATGTG motif, both in vivo and in vitro (Figures 1B and 3). In addition, the gel mobility shift experiment showed that the NAC proteins could bind to NACRS as multimers (Figure 3). Structural studies of the NAC domain of ANAC019 also suggest that the NAC domain of ANAC019 mediated dimerization of the NAC proteins through conserved interactions (Ernst et al., 2004
). It is worthy to note that the NAC domains of ANAC019, ANAC055, and ANAC072 are highly conserved; thus, they might also be able to heterodimerize. This possible heterodimerization might potentiate transcriptional activity of the NAC proteins, which would have a significant effect on expression of target genes, consequently on stress response. Using the yeast one-hybrid system, we identified the complete NACRS binding sequence and the core DNA binding motif (CACG) for the newly identified NAC proteins within the 63-bp fragment of the erd1 promoter (Figures 5, 6, 7, and 8). The Arabidopsis NAC1 protein has been shown to bind to a 21-bp segment (CTGACGTAAGGGATGACGCAC) within the 35S 90 promoter fragment (Xie et al., 2000
). Independently, Duval et al. (2002)
demonstrated that purified AtNAM recombinant protein, another NAC protein, protected the region of the CaMV 35S promoter between 70 and 76, which is located and underlined in the 21-bp segment. The newly identified CACG core motif is not found within the 21-bp segment, but we cannot exclude the possibility that ANAC019, ANAC055, and ANAC072 can also bind to that segment. Indeed, at least for ANAC019, Ernst et al. (2004)
have reported that the NAC domain of ANAC019 could bind to the 90 to +9 fragment of the CaMV promoter as both monomer and dimer. In addition, among the upregulated genes listed in Tables 1, 2, and 3, nine genes do not contain the CACG core motif in their promoter region. However, the promoter regions of these genes have similar motifs with high homology to the AGGGATG sequence (data not shown).
Expression of ANAC019 and especially of ANAC072 was strongly induced by dehydration and high-salinity treatment within 1 to 2 h, whereas that of ANAC055 was only induced markedly by high-salt stress. Expression of erd1 was also observed 1 to 2 h after dehydration and high-salt stress (Nakashima et al., 1997
). Thus, the NAC proteins likely function upstream of the erd1 gene and transactivate gene expression in response to these stresses. Because the ANAC019 and ANAC055 transcripts accumulated to a higher level in plants under high-salt stress than in those under dehydration stress, these two transcription factors probably play a major role in high-salt stress rather than in drought conditions. The ANAC072 mRNA, meanwhile, accumulated to higher levels in plants experiencing dehydration rather than under high-salt stress, suggesting that ANAC072's role is associated mainly with the plant response to dehydration. To more precisely elucidate the function of the NAC genes in the signal transduction pathway leading to the activation of erd1, we are currently analyzing anac019, anac055, and anac072 mutants. Nakashima et al. (1997)
showed that the erd1 promoter was not strongly affected by ABA treatment because induction of erd1 mRNA accumulation occurred earlier than did the increase of endogenous ABA, whose accumulation began to increase 2 h after Arabidopsis plants had been subjected to dehydration stress (Kiyosue et al., 1994
). Expression of the NAC genes was observed also within 1 to 2 h after ABA treatment, suggesting that dehydration-regulated expression of the NAC genes and of erd1 does not require endogenous ABA. The NAC genes, especially ANAC072, do respond to exogenous ABA. These NAC proteins may also regulate ABA-responsive genes as target genes. In addition, histochemical assays showed that in response to high salinity and ABA treatment, the NAC promoters direct protein accumulation mainly in the leaves of affected Arabidopsis plants (Figure 10B). Similarly, Nakashima et al. (1997)
reported that in transgenic plants containing an erd1 promoter-GUS fusion construct, GUS gene expression was localized to the leaves in plants experiencing abiotic stresses.
Microarray analysis of the 35S:ANAC019, 35S:ANAC055, and 35S:ANAC072 plants revealed that several genes were upregulated by overexpression of ANAC019, ANAC055, and ANAC072, respectively (Tables 1, 2, and 3). One gene, RAFL06-15-P15, was overexpressed by either ANAC019, ANAC055, or ANAC072 overproduction. RAFL06-16-O09 was upregulated by both ANAC019 and ANAC055, RAFL05-18-K08 by both ANAC055 and ANAC072, RAFL06-11-F15 and RAFL05-02-O17 by both ANAC019 and ANAC072 overexpression, and the others were either ANAC019, ANAC055, or ANAC072 dependent (Tables 1, 2, and 3). This result indicated that there may be nonoverlapping and overlapping targets for the NAC proteins. We used three nonoverlapping target genesRAFL06-13-E03, RD20, and RAFL09-10-F18, which are upregulated by ANAC072 overproduction (Figure 11)as probes for RNA gel blot analysis to assess the ability of these three NAC proteins to recognize target genes. With the exception of RAFL06-13-E03, whose expression was clearly induced by overexpression of ANAC055 but not of ANAC019, the transcription of the other two genes remained mostly unchanged after the overexpression of either ANAC019 or ANAC055 (Figure 11).
Transcript levels of erd1 were largely unaffected in transgenic plants overexpressing the NAC genes (Figure 11). Moreover, the expression levels of erd1 in the transgenic plants that were exposed to drought stress also remained relatively unchanged when compared with the vector control plants (data not shown). Simpson et al. (2003)
showed that during water stress, erd1 transcription is controlled by coordinated activity between two cis-acting elements, the CATGTG motif and the 14-bp rps1 site 1like sequence. On the other hand, the several-fold induction of the GUS reporter gene driven by the erd1 promoter region containing NACRS in the transient transactivation assay using Arabidopsis T87 protoplasts (Figure 4) may be because of osmotic stress imposed on the T87 protoplasts themselves. Because the overexpression of NAC does not induce the transcription of erd1, we hypothesize that ANAC019 and/or ANAC055 and/or ANAC072 bind to the NACRS sequence, and transcription factors that bind the 14-bp rps1 site 1like sequence cooperatively form a structure called an enhanceosome to control the dehydration-inducible transcription of erd1. To gain a better understanding of the signaling pathway that leads to the activation of erd1, we recently isolated zinc-finger homeodomain transcription factors containing a homeodomain that can bind to the rps1 site 1like sequence using the yeast one-hybrid system. Overexpression of both NAC and zinc-finger homeodomain proteins activated the expression of erd1 under unstressed normal growth conditions in the transgenic Arabidopsis plants (our unpublished data).
In Arabidopsis transgenic plants, ANAC019, ANAC055, and ANAC072 overexpression increased drought stress tolerance (Figure 12C). This may be because of the overexpression of stress-inducible genes that are controlled by ANAC019, ANAC055, and ANAC072 under unstressed conditions because several stress-inducible genes were upregulated by overexpression of ANAC019, ANAC055, and ANAC072 among the 7000 cDNAs screened (Tables 1, 2, and 3). Of these identified target genes, the expression of RAFL06-15-P15, which encodes glyoxalase I family protein, was clearly correlated with the relative expression level of ANAC019, ANAC055, and ANAC072 (Figure 11). Glyoxalase enzymes are important for the glutathione-based detoxification of methylglyoxal, which is formed primarily as a byproduct of carbohydrate and lipid metabolism (Thornalley, 2003
). Singla-Pareek et al. (2003)
have reported that overexpression of Brassica juncea glyoxalase I and Oryza sativa glyoxalase II, either alone or together, confers improved salinity tolerance in tobacco (Nicotiana tabacum). Moreover, reduction of the cytotoxic methylglyoxal by overexpression of a drought-inducible alfalfa (Medicago sativa) NADPH-dependent aldose/aldehyde reductase protects transgenic tobacco against drought stress (Oberschall et al., 2000
). Therefore, we postulate that the improved resistance of the ANAC019, ANAC055, and ANAC072 transgenic lines against drought stress is primarily derived from the reduction and, thus, detoxification of toxic aldehydes through the glyoxalase pathway. Alternatively, ANAC019-, ANAC055-, and ANAC072-dependent expression levels of other unknown target genes may have an impact on drought stress tolerance as well because we could expect to find more target genes of ANAC019, ANAC055, and ANAC072 if a higher number of genes were screened.
| METHODS |
|---|
|
|
|---|
Yeast One-Hybrid Screening of Arabidopsis cDNA Libraries
Reporter plasmids were constructed and the yeast reporter strain was selected as described (Liu et al., 1998
). Approximately 1.8 x 106 and 4 x 106 yeast transformants were screened according to the manufacturer's protocol (Clontech Matchmaker one-hybrid system; Palo Alto, CA) using 40 µg of AD-cDNA libraries prepared from unstressed and 3-h-dehydrated Arabidopsis plants as previously described (Liu et al., 1998
). The unstressed and 3-h-dehydrated primary libraries have 5.8 x 106 pfu and 6.2 x 106 pfu, respectively. Forty-nine positive colonies were obtained from selective plates containing 10 mM 3-AT. When a colony-lift filter assay was performed as described in the Yeast Protocols Handbook (Clontech) to verify the DNAprotein interaction, all 49 colonies conferred ß-Gal activity. The cDNA isolation, subcloning, and sequencing of these 49 clones were performed as described (Liu et al., 1998
). To analyze the binding specificity of isolated cDNA clones, we used four tandemly repeated copies of a mutated 63-bp fragment in which the CATGTG motif was replaced with AAAAAA for the construction of the reporter plasmids.
RNA Gel Blot Analyses
RNA extraction and gel blot hybridization were performed as described (Nakashima and Yamaguchi-Shinozaki, 2002
).
Construction of Transgenic Plants Containing the PNAC-GUS Fusion and Histochemical Assay
The 1030-, 983-, and 868-bp fragments upstream of the starting codon ATG containing the promoter regions of the ANAC019, ANAC055, and ANAC072 genes were cloned by PCR and inserted into GUS expression vector pBI101.1. The sequence of the promoter fragments was then verified by sequencing. Plasmids containing the NAC promoterGUS fusions were introduced into Arabidopsis to make transgenic plants. Histochemical assay was done essentially as described previously (Nakashima and Yamaguchi-Shinozaki, 2002
).
Transactivation Experiment with T87 Protoplasts
cDNA fragments encoding ANAC019, ANAC055, and ANAC072 were cloned into plant expression vector pBI35S
(Abe et al., 1997
) and cotransformed into T87 protoplasts with the reporter gene plasmid pBIerd1NACRSWT (reporter WT) or pBIerd1NACRSM1 (reporter M1). To construct these reporter plasmids, we ligated one copy of the 63-bp wild-type or M1 fragments containing the CATGTG or AAAAAA motifs in place of CATGTG, respectively, to the HindIII site of pSKTATA (Simpson et al., 2003
) to make WT-Perd1 and M1-Perd1 fused fragments, which were then used to replace the CaMV 35S promoter in pBI221. T87 Arabidopsis protoplasts were transactivated according to Satoh et al. (2004)
.
Determination of the Complete NACRS and Core Sequence by Yeast One-Hybrid System
All the fragments, wild-type as well as single- or triple-base-substituted 63-bp fragments, were bluntly generated by PCR and cloned directly into the SmaI site of reporter plasmid pLacZi. The sequence of the inserts was confirmed, and then the derived plasmids were linearized and integrated into the genome of yeast strain YM4271 to construct the respective reporter strains. pAD-GAL4 derivatives, the pAD-GAL4-ANAC019, the pAD-GAL4-ANAC055, and the pAD-GAL4-ANAC072 were used as binding and activating plasmids in one-hybrid experiments. For control, plasmid pAD-WT containing a fragment encoding amino acids 132 to 236 of wild-type
cI repressor was used (HybriZAP-2.1 XR library construction kit and HybriZAP-2.1 XR cDNA synthesis kit; Stratagene, La Jolla, CA).
Liquid Culture Assay for ß-Galactosidase Activity
ß-Galactosidase activity, expressed in Miller units, was measured as described in the Yeast Protocols Handbook (Clontech) using o-nitrophenyl-ß-D-galactopyranoside as a substrate.
Preparation of GST Fusion Proteins and Gel Retardation Assay
Fragments encoding ANAC019, ANAC055, and ANAC072 were PCR amplified and fused to the pGEX-4T-2 vector (Amersham Biosciences, Buckinghamshire, UK). The recombinant pGEX-4T-2 plasmids were introduced into Escherichia coli strain BL21. GST fusion proteins were produced and purified as described (Urao et al., 1993
). Gel shift assays were conducted according to Sakuma et al. (2002)
.
Arabidopsis Full-Length cDNA Microarray Analysis
cDNAs encoding ANAC019, ANAC055, and ANAC072 were inserted into plasmid pBI35S
Hyg (Abe et al., 2003
), and the resulting plasmids pBI35S
:ANAC019Hyg (35S:ANAC019), pBI35S
:ANAC055Hyg (35S:ANAC055), and pBI35S
:ANAC072Hyg (35S:ANAC072) were introduced into Arabidopsis to generate transgenic plants overexpressing ANAC019, ANAC055, or ANAC072. As the control, transgenic plants containing pBI35S
Hyg without the insert were used. Total RNA was isolated from plants using TRIZOL reagent (Invitrogen, Carlsbad, CA). One milligram of total RNA was used for isolation of mRNA by PolyATtract mRNA isolation systems (Promega, Madison, WI). One microgram of mRNA was employed on microarray analysis. Microarray analysis was performed as described previously (Seki et al., 2002a
, 2002b
). mRNA samples from plants overexpressing NAC were fluorescently labeled with Cy5-dUTP and samples from vector control plants labeled with Cy3-dUTP.
-DNA (Takara, Tokyo, Japan) was used as an internal control because its fluorescence level is almost the same in the two conditions. To assess the reproducibility of microarray analysis, each experiment was repeated three times.
Drought Stress Tolerance of Transgenic Plants
Plants were grown aseptically in Petri dishes containing selective agar germination medium for 3 weeks, then transferred to 8-cm pots filled with a 1:1 mixture of perlite and vermiculite, and grown for one more week before exposure to drought stress. Drought stress was imposed by withholding water for 9 d in a growth chamber (22°C, 50 to 60% relative humidity, continuous 55 µmol m2 s1 photon flux density) until the lethal effect of dehydration was observed on most of the control plants. After rewatering for 3 d, the numbers of plants that survived and continued to grow were counted.
Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AY117224, AB049070, and AY091428 for ANAC019 (At1g52890), ANAC055 (At3g15500), and ANAC072 (At4g27410), respectively.
| Acknowledgments |
|---|
| Footnotes |
|---|
Online version contains Web-only data. ![]()
Article, publication date, and citation information can be found at www.plantcell.org/cgi/doi/10.1105/tpc.104.022699.
Received March 19, 2004; accepted June 24, 2004.
| REFERENCES |
|---|
|
|
|---|
Abe, H., Yamaguchi-Shinozaki, K., Urao, T., Iwasaki, T., Hosokawa, D., and Shinozaki, K. (1997). Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. Plant Cell 9, 18591868.[Abstract]
Axelos, M., Curie, C., Mazzolini, L., Bardet, C., and Lescure, B. (1992). A protocol for transient gene expression in Arabidopsis thaliana protoplasts isolated from cell suspension cultures. Plant Physiol. Biochem. 30, 123128.
Bray, E., Bailey-Serresand, J., and Weretilnyk, E. (2000). Responses to abiotic stresses. In Biochemistry and Molecular Biology of Plants, B. Buchanan, W. Gruissem, and J.R. Rockville, eds (Rockville, MD: American Society of Plant Biologists), pp. 11581203.
Choi, H., Hong, J., Ha, J., Kang, J., and Kim, S.Y. (2000). ABFs, a family of ABA-responsive element binding factors. J. Biol. Chem. 275, 17231730.
Duval, M., Hsieh, T.F., Kim, S.Y., and Thomas, T.L. (2002). Molecular characterization of AtNAM: A member of the Arabidopsis NAC domain superfamily. Plant Mol. Biol. 50, 237248.[CrossRef][Web of Science][Medline]
Ernst, H.A., Olsen, A.N., Larsen, S., and Lo Leggio, L. (2004). Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors. EMBO Rep. 5, 297303.[CrossRef][Web of Science][Medline]
Fowler, S., and Thomashow, M.F. (2002). Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14, 16751690.
Greve, K., La Cour, T., Jensen, M.K., Poulsen, F.M., and Skriver, K. (2003). Interactions between plant RING-H2 and plant-specific NAC (NAM/ATAF1/2/CUC2) proteins: RING-H2 molecular specificity and cellular localization. Biochem. J. 371, 97108.[CrossRef][Web of Science][Medline]
Hegedus, D., Yu, M., Baldwin, D., Gruber, M., Sharpe, A., Parkin, I., Whitwill, S., and Lydiate, D. (2003). Molecular characterization of Brassica napus NAC domain transcriptional activators induced in response to biotic and abiotic stress. Plant Mol. Biol. 53, 383397.[CrossRef][Web of Science][Medline]
Ingram, J., and Bartels, D. (1996). The molecular basis of dehydration tolerance in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 47, 377403.[CrossRef][Web of Science][Medline]
Jaglo-Ottosen, K.R., Gilmour, S.J., Zarka, D.G., Schabenberger, O., and Thomashow, M.F. (1998). Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 280, 104106.
Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K., and Shinozaki, K. (1999). Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat. Biotechnol. 17, 287291.[CrossRef][Web of Science][Medline]
Kiyosue, T., Yamaguchi-Shinozaki, K., and Shinozaki, K. (1993). Characterization of a cDNA for a dehydration-inducible gene that encodes a Clp A, B-like protein in Arabidopsis thaliana L. Biochem. Biophys. Res. Commun. 196, 12141220.[CrossRef][Web of Science][Medline]
Kiyosue, T., Yamaguchi-Shinozaki, K., and Shinozaki, K. (1994). Cloning of cDNAs for genes that are early-responsive to dehydration stress (ERDs) in Arabidopsis thaliana L.: Identification of three ERDs as HSP cognate genes. Plant Mol. Biol. 25, 791798.[CrossRef][Web of Science][Medline]
Künzler, M., Braus, G.H., Georgiev, O., Seipel, K., and Schaffner, W. (1994). Functional differences between mammalian transcription activation domains at the yeast GAL1 promoter. EMBO J. 13, 641645.[Web of Science][Medline]
Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki, K., and Shinozaki, K. (1998). Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10, 13911406.
Maruyama, K., Sakuma, Y., Kasuga, M., Ito, Y., Seki, M., Goda, H., Shimada, Y., Yoshida, S., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2004). Identification of cold-inducible downstream genes of the Arabidopsis DREB1A/CBF3 transcriptional factor using two microarray systems. Plant J. 38, 982993.[CrossRef][Web of Science][Medline]
Nakashima, K., Kiyosue, T., Yamaguchi-Shinozaki, K., and Shinozaki, K. (1997). A nuclear gene encoding a chloroplast-targeted Clp protease regulatory subunit homolog is not only induced by water stress but also developmentally up-regulated during senescence in Arabidopsis thaliana. Plant J. 12, 851861.[CrossRef][Web of Science][Medline]
Nakashima, K., and Yamaguchi-Shinozaki, K. (2002). Use of ß-glucuronidase to show dehydration and high-salt gene expression. In Molecular Methods of Plant Analysis: Testing for Genetic Manipulation in Plants, Vol. 22, J.F. Jackson, H.F. Linsken, and R.B. Inman, eds (Berlin: Springer-Verlag), pp. 3761.
Oberschall, A., Deak, M., Torok, K., Sass, L., Vass, I., Kovacs, I., Feher, A., Dudits, D., and Horvath, G.V. (2000). A novel aldose/aldehyde reductase protects transgenic plants against lipid peroxidation under chemical and drought stresses. Plant J. 24, 437446.[CrossRef][Web of Science][Medline]
Ooka, H., et al. (2003). Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Res. 20, 239247.
Pastori, G.M., and Foyer, C.H. (2002). Common components, networks, and pathways of cross-tolerance to stress. The central role of "redox" and abscisic acid-mediated controls. Plant Physiol. 129, 460468.
Riechmann, J.L., et al. (2000). Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes. Science 290, 21052110.
Sakuma, Y., Liu, Q., Dubouzet, J.G., Abe, H., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2002). DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 290, 9981009.[CrossRef][Web of Science][Medline]
Satoh, R., Fujita, Y., Nakashima, K., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2004). A novel subgroup of bZIP proteins functions as transcriptional activators in hypoosmolarity-responsive expression of the ProDH gene in Arabidopsis. Plant Cell Physiol. 45, 309317.
Seki, M., et al. (2002a). Monitoring the expression pattern of around 7000 Arabidopsis genes under ABA treatments using a full-length cDNA microarray. Funct. Integr. Genomics 2, 282291.[CrossRef][Medline]
Seki, M., Kamei, A., Yamaguchi-Shinozaki, K., and Shinozaki, K. (2003). Molecular responses to drought, salinity and frost: Common and different paths for plant protection. Curr. Opin. Biotechnol. 14, 194199.[CrossRef][Web of Science][Medline]
Seki, M., Narusaka, M., Abe, H., Kasuga, M., Yamaguchi-Shinozaki, K., Carninci, P., Hayashizaki, Y., and Shinozaki, K. (2001). Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full-length cDNA microarray. Plant Cell 13, 6172.
Seki, M., et al. (2002b). Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray. Plant J. 31, 279292.[CrossRef][Web of Science][Medline]
Seki, M., et al. (2002c). Functional annotation of a full-length Arabidopsis cDNA collection. Science 296, 141145.
Shinozaki, K., and Yamaguchi-Shinozaki, K. (2000). Molecular responses to dehydration and low temperature: Differences and cross-talk between two stress signaling pathways. Curr. Opin. Plant Biol. 3, 217223.[Web of Science][Medline]
Shinozaki, K., Yamaguchi-Shinozaki, K., and Seki, M. (2003). Regulatory network of gene expression in the drought and cold stress responses. Curr. Opin. Plant Biol. 6, 410417.[CrossRef][Web of Science][Medline]
Simpson, S.D., Nakashima, K., Narusaka, Y., Seki, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2003). Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene, function in induction by dehydration stress and dark-induced senescence. Plant J. 33, 259270.[CrossRef][Web of Science][Medline]
Singla-Pareek, S.L., Reddy, M.K., and Sopory, S.K. (2003). Genetic engineering of the glyoxalase pathway in tobacco leads to enhanced salinity tolerance. Proc. Natl. Acad. Sci. USA 100, 1467214677.
Takada, S., Hibara, K., Ishida, T., and Tasaka, M. (2001). The CUP-SHAPED COTYLEDON1 gene of Arabidopsis regulates shoot apical meristem formation. Development 128, 11271135.[Abstract]
Thomashow, M.F. (1999). Plant cold acclimation: Freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 571599.[CrossRef][Web of Science]
Thornalley, P.J. (2003). Glyoxalase IStructure, function and a critical role in the enzymatic defence against glycation. Biochem. Soc. Trans. 31, 13431348.[Web of Science][Medline]
Triezenberg, S.J. (1995). Structure and function of transcriptional activation domains. Curr. Opin. Genet. Dev. 5, 190196.[CrossRef][Medline]
Uno, Y., Furihata, T., Abe, H., Yoshida, R., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2000). Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc. Natl. Acad. Sci. USA 97, 1163211637.
Urao, T., Yamaguchi-Shinozaki, K., Urao, S., and Shinozaki, K. (1993). An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5, 15291539.[Abstract]
Xie, Q., Frugis, G., Colgan, D., and Chua, N.H. (2000). Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development. Genes Dev. 14, 30243036.
Yamaguchi-Shinozaki, K., Koizumi, M., Urao, S., and Shinozaki, K. (1992). Molecular cloning and characterization of 9 cDNAs for genes that are responsive to desiccation in Arabidopsis thaliana: Sequence analysis of one cDNA clone that encodes a putative transmembrane channel protein. Plant Cell Physiol. 33, 217224.
Zhu, J.K. (2002). Salt and drought stress signal transduction in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 53, 247273.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. Lehmann, M. Schwarzlander, T. Obata, S. Sirikantaramas, M. Burow, C. E. Olsen, T. Tohge, M. D. Fricker, B. L. Moller, A. R. Fernie, et al. The Metabolic Response of Arabidopsis Roots to Oxidative Stress is Distinct from that of Heterotrophic Cells in Culture and Highlights a Complex Relationship between the Levels of Transcripts, Metabolites, and Flux Mol Plant, May 1, 2009; 2(3): 390 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Bu, H. Li, Q. Zhao, H. Jiang, Q. Zhai, J. Zhang, X. Wu, J. Sun, Q. Xie, D. Wang, et al. The Arabidopsis RING Finger E3 Ligase RHA2a Is a Novel Positive Regulator of Abscisic Acid Signaling during Seed Germination and Early Seedling Development Plant Physiology, May 1, 2009; 150(1): 463 - 481. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Christianson, I. W. Wilson, D. J. Llewellyn, and E. S. Dennis The Low-Oxygen-Induced NAC Domain Transcription Factor ANAC102 Affects Viability of Arabidopsis Seeds following Low-Oxygen Treatment Plant Physiology, April 1, 2009; 149(4): 1724 - 1738. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alexandre, Y. Moller-Steinbach, N. Schonrock, W. Gruissem, and L. Hennig Arabidopsis MSI1 Is Required for Negative Regulation of the Response to Drought Stress Mol Plant, March 27, 2009; (2009) ssp012v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. M. Saibo, T. Lourenco, and M. M. Oliveira Transcription factors and regulation of photosynthetic and related metabolism under environmental stresses Ann. Bot., February 1, 2009; 103(4): 609 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nakashima, Y. Ito, and K. Yamaguchi-Shinozaki Transcriptional Regulatory Networks in Response to Abiotic Stresses in Arabidopsis and Grasses Plant Physiology, January 1, 2009; 149(1): 88 - 95. [Full Text] [PDF] |
||||
![]() |
Y. Ogo, T. Kobayashi, R. Nakanishi Itai, H. Nakanishi, Y. Kakei, M. Takahashi, S. Toki, S. Mori, and N. K. Nishizawa A Novel NAC Transcription Factor, IDEF2, That Recognizes the Iron Deficiency-responsive Element 2 Regulates the Genes Involved in Iron Homeostasis in Plants J. Biol. Chem., May 9, 2008; 283(19): 13407 - 13417. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-S. P. Tran, T. Urao, F. Qin, K. Maruyama, T. Kakimoto, K. Shinozaki, and K. Yamaguchi-Shinozaki Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis PNAS, December 18, 2007; 104(51): 20623 - 20628. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Kim, B. O. Park, J. H. Yoo, M. S. Jung, S. M. Lee, H. J. Han, K. E. Kim, S. H. Kim, C. O. Lim, D.-J. Yun, et al. Identification of a Calmodulin-binding NAC Protein as a Transcriptional Repressor in Arabidopsis J. Biol. Chem., December 14, 2007; 282(50): 36292 - 36302. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Medina, M. L. Ballesteros, and J. Salinas Phylogenetic and functional analysis of Arabidopsis RCI2 genes J. Exp. Bot., December 1, 2007; 58(15-16): 4333 - 4346. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Iuchi, H. Koyama, A. Iuchi, Y. Kobayashi, S. Kitabayashi, Y. Kobayashi, T. Ikka, T. Hirayama, K. Shinozaki, and M. Kobayashi Zinc finger protein STOP1 is critical for proton tolerance in Arabidopsis and coregulates a key gene in aluminum tolerance PNAS, June 5, 2007; 104(23): 9900 - 9905. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Freeling, L. Rapaka, E. Lyons, B. Pedersen, and B. C. Thomas G-Boxes, Bigfoot Genes, and Environmental Response: Characterization of Intragenomic Conserved Noncoding Sequences in Arabidopsis PLANT CELL, May 1, 2007; 19(5): 1441 - 1457. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Y. Kim, S.-G. Kim, Y.-S. Kim, P. J. Seo, M. Bae, H.-K. Yoon, and C.-M. Park Exploring membrane-associated NAC transcription factors in Arabidopsis: implications for membrane biology in genome regulation Nucleic Acids Res., January 12, 2007; 35(1): 203 - 213. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Obayashi, K. Kinoshita, K. Nakai, M. Shibaoka, S. Hayashi, M. Saeki, D. Shibata, K. Saito, and H. Ohta ATTED-II: a database of co-expressed genes and cis elements for identifying co-regulated gene groups in Arabidopsis Nucleic Acids Res., January 12, 2007; 35(suppl_1): D863 - D869. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Mane, C. Vasquez-Robinet, A. A. Sioson, L. S. Heath, and R. Grene Early PLD{alpha}-mediated events in response to progressive drought stress in Arabidopsis: a transcriptome analysis J. Exp. Bot., January 1, 2007; 58(2): 241 - 252. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shinozaki and K. Yamaguchi-Shinozaki Gene networks involved in drought stress response and tolerance J. Exp. Bot., January 1, 2007; 58(2): 221 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Kim, S.-G. Kim, J.-E. Park, H.-Y. Park, M.-H. Lim, N.-H. Chua, and C.-M. Park A Membrane-Bound NAC Transcription Factor Regulates Cell Division in Arabidopsis PLANT CELL, November 1, 2006; 18(11): 3132 - 3144. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hu, M. Dai, J. Yao, B. Xiao, X. Li, Q. Zhang, and L. Xiong Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice PNAS, August 29, 2006; 103(35): 12987 - 12992. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ogo, R. N. Itai, H. Nakanishi, H. Inoue, T. Kobayashi, M. Suzuki, M. Takahashi, S. Mori, and N. K. Nishizawa Isolation and characterization of IRO2, a novel iron-regulated bHLH transcription factor in graminaceous plants J. Exp. Bot., August 1, 2006; 57(11): 2867 - 2878. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Benedict, M. Geisler, J. Trygg, N. Huner, and V. Hurry Consensus by Democracy. Using Meta-Analyses of Microarray and Genomic Data to Model the Cold Acclimation Signaling Pathway in Arabidopsis Plant Physiology, August 1, 2006; 141(4): 1219 - 1232. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-h. Lee, D. A. Henderson, and J.-K. Zhu The Arabidopsis Cold-Responsive Transcriptome and Its Regulation by ICE1 PLANT CELL, November 1, 2005; 17(11): 3155 - 3175. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Suzuki, M. G. Ketterling, and D. R. McCarty Quantitative Statistical Analysis of cis-Regulatory Sequences in ABA/VP1- and CBF/DREB1-Regulated Genes of Arabidopsis Plant Physiology, September 1, 2005; 139(1): 437 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kubo, M. Udagawa, N. Nishikubo, G. Horiguchi, M. Yamaguchi, J. Ito, T. Mimura, H. Fukuda, and T. Demura Transcription switches for protoxylem and metaxylem vessel formation Genes & Dev., August 15, 2005; 19(16): 1855 - 1860. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhao, J. C. Craig, H. E. Petzold, A. W. Dickerman, and E. P. Beers The Xylem and Phloem Transcriptomes from Secondary Tissues of the Arabidopsis Root-Hypocotyl Plant Physiology, June 1, 2005; 138(2): 803 - 818. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | THE PLANT CELL | PLANT PHYSIOLOGY | |
|---|---|---|---|