|
|
||||||||
|
First published online May 27, 2005; 10.1105/tpc.105.031856 © 2005 American Society of Plant Biologists
Arabidopsis Peroxisomal Citrate Synthase Is Required for Fatty Acid Respiration and Seed Germination
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
|
Mutations that block peroxisomal fatty acid ß-oxidation have marked effects on Arabidopsis seed germination and plant growth. For example, the peroxisome deficient-1 (ped1) or 3-ketoacyl CoA thiolase-2 (kat2) mutation that eliminates the major 3-ketoacyl thiolase produces seeds that germinate but then require sucrose to develop into seedlings (Hayashi et al., 1998
; Germain et al., 2001
). The seedlings do not metabolize their TAG, and peroxisome development is abnormal (Germain et al., 2001
). The COMATOSE (CTS) gene encodes an ABC-type transporter that is thought to import acyl-CoAs into the peroxisome for ß-oxidation (Footitt et al., 2002
). cts mutant seeds are dormant but can be made to germinate by removing the seed coat and providing sucrose. Such seedlings do not metabolize their TAG (Footitt et al., 2002
). Mutants lacking peroxisomal long-chain acyl-CoA synthetase are similar to kat2 mutants, in that they require sucrose to progress from germinated seed to seedling, and they do not metabolize TAG (Fulda et al., 2004
). The abnormal inflorescence meristem1 (aim1) mutation, which eliminates one of the two multifunctional proteins (MFP), indicates the importance of ß-oxidation during floral development (Richmond and Bleecker, 1999
). A double mutant in which two members of the acyl-CoA oxidase (ACX) gene family are mutated (acx3 and acx4) is embryo lethal, showing that ß-oxidation is essential for seed development as well as germination (Rylott et al., 2003
). Thus, it is clear from studies in which fatty acid ß-oxidation is blocked that distinct phenotypes are obtained.
The hypothesis that an acylcarnitine shuttle transfers carbon from peroxisome to mitochondrion during TAG metabolism in plants is not easily tested because an acyl-CoA carnitine acetyltransferase has not yet been found and the function of BOU is unclear. However, the hypothesis that carbon is exported from the peroxisome in the form of citrate predicts an essential role for peroxisomal CSY in the respiration of TAG. In yeast, elimination of peroxisomal CSY has no effect on fatty acid respiration (van Roermund et al., 1995
) because of the operation of the acetylcarnitine shuttle (van Roermund et al., 1999
). Here, we test the hypothesis that CSY is required for TAG respiration in Arabidopsis.
| RESULTS |
|---|
|
|
|---|
To determine which of the putative peroxisomal CSY genes are expressed in germinating seeds and developing seedlings, gene-specific oligonucleotide primers were designed so that transcripts of each gene could be detected by RT-PCR. Because of the high degree of sequence similarity between peroxisomal CSY genes, the specificity of the primers was determined in two ways. First, the RT-PCR products obtained with each primer combination were digested with restriction endonucleases that could distinguish different gene products. The results obtained showed that RT-PCR products obtained with each primer pair were of the predicted size and were digested with specific endonucleases to products of the expected sizes (Figure 2A). Second, the nucleotide sequences of the RT-PCR products were determined and shown to correspond to the predicted gene in each case (data not shown).
|
To confirm the peroxisomal targeting of Arabidopsis CSY2 and CSY3, constructs were made encoding the putative PTS2 sequences of each gene fused to green fluorescent protein (GFP) and the Cauliflower mosaic virus (CaMV) 35S promoter (Figure 3A). To confirm the identity of peroxisomes, a further construct was made encoding monomeric red fluorescent protein (mRFP) with a PTS1 sequence at the C-terminal end (Figure 3A). This PTS1 comprised the 10 C-terminal amino acids of pumpkin malate synthase that had previously been verified to transport RFP to peroxisomes in Arabidopsis (Lin et al., 2004
). Plants were transformed with GFP and mRFP transgenes and then crossed and fluorescence observed in the root hairs of seedlings expressing both fluorescent proteins (Figure 3B). Both CSY2 and CSY3 putative PTS2 sequences target GFP to the same microbodies to which PTS1 targets mRFP (Figure 3B). No evidence for targeting of GFP to other organelles was observed. This confirms the peroxisomal targeting of CSY2 and CSY3.
|
|
The csy Double Knockout Has a Dormant Seed Phenotype
Mutants of csy2 and csy3 were crossed to make double mutants. The F1 double heterozygotes appeared to grow and develop normally, and after selfing, seedlings and plants heterozygous for one csy gene and homozygous mutant for the other csy gene were readily obtained. Thus, only one functional copy of either CSY2 or 3 is sufficient for plant growth and development. By contrast, no csy2 csy3 homozygous double mutant seedlings could be detected in the F2 generation. However, a small proportion of seeds did not germinate, even when provided with exogenous sucrose. The cts mutant germinates at a very low frequency even when provided with sucrose but can be induced to germinate by removal of the seed coat (Footitt et al., 2002
). To determine if csy2 csy3 mutants have a similar dormant phenotype, seeds from the F1 heterozygotes that failed to germinate after 5 d of incubation in the presence of sucrose were surgically disrupted to expose or remove the embryo and incubated further in the presence of 3% (w/v) sucrose. Such embryos grew and developed into seedlings, although they grew more slowly than the wild type, and they contained anthocyanins indicative of stress (Figure 5A). PCR analysis on DNA from such seedlings (data not shown) and RT-PCR analysis on RNA (Figure 5B) demonstrated that they were homozygous csy2 csy3 double mutants.
|
The dormancy of homozygous csy2 csy3 double mutant seeds could be due to a deficiency in the embryo itself, which might be overcome when the physical constraints of the seed coat are removed, or to a maternal effect of the surrounding endosperm or seed coat inhibiting embryo metabolism or growth. Dormant double mutant seed was obtained whether the maternal genotype was heterozygous for csy2 and csy3 or was homozygous for either csy2 or csy3 and heterozygous for the other gene.
Double mutant seedlings, whether obtained by surgical treatment or by rare spontaneous germination, failed to establish as mature plants either when maintained on sucrose in vitro or when transferred to soil. By contrast, the cts mutant flowered and produced seed readily when grown in soil (data not shown). Thus, we could not obtain supplies of seeds from homozygous csy2 csy3 double mutant plants. Instead, double mutant seed was routinely obtained from plants homozygous for csy2 and heterozygous for csy3. Approximately 25% of seed failed to germinate after several days of incubation at 20°C, of which a very high proportion was csy2 csy3 homozygous double mutant seed. Such seeds could be used for analysis of the double mutant phenotype. Seeds that did not germinate after 2 d of incubation on plates were induced to germinate by seed coat removal. Two days later, they were assayed for total CSY activity, together with 2-d-old wild-type, csy2, and csy3 seedlings that had germinated normally. The results show that the double mutant seedlings contain only
25% of CSY activity compared with the wild type (Figure 5C). The remaining CSY activity is assumed to be mitochondrial.
The Mutant Phenotype Is Caused Specifically by the Lack of Peroxisomal CSY
To confirm that the dormant seed phenotype observed in the csy2 csy3 double mutant is due to mutations in the CSY genes and not due to secondary mutations caused during transformation by T-DNA, double mutants were made in all four possible combinations involving the two mutant alleles of each gene. In all cases, a dormant seed phenotype was observed (see Supplemental Table 1 online). To confirm that the phenotype is not due to inherent disruption of expression of other specific genes caused as a consequence of T-DNA insertion in a CSY gene, transgenic complementation was undertaken. The transgene employed comprised the 35S promoter linked to a CSY3 cDNA. Plants that were homozygous csy3/csy3 and heterozygous CSY2/csy2 were subjected to the floral dipping transformation procedure using Agrobacterium tumefaciens (Clough and Bent, 1998
). The seeds from these plants were plated on hygromycin to select for transformants. Several of the transformants obtained were double homozygous csy2 csy3 mutants containing the transgene (data not shown), which grew normally (Figure 5D).
To establish that CSY functions specifically in the peroxisome and not in the mitochondrion because of possible dual targeting of the PTS2 sequence (Lee et al., 2000
), complementation was also performed with a transgene encoding CSY3 targeted to the peroxisome by a PTS1 sequence. The coding information for the 20 N-terminal amino acids of the PTS2 sequence was removed, and the 10 amino acids from the C-terminal end of pumpkin malate synthase that includes the PTS1 sequence (Hayashi et al., 1996
) were added to the CSY3 cDNA. Again, plants that were homozygous csy3/csy3 and heterozygous CSY2/csy2 were subjected to the floral dipping transformation procedure using Agrobacterium. The seeds from these plants were plated on hygromycin to select for transformants. Several of the transformants obtained were double homozygous csy2 csy3 mutants containing the transgene (data not shown). Such plants grew normally (Figures 5D and 5E). We conclude that the dormant seed and impaired plant growth phenotype is caused by the absence of peroxisomal CSY.
The csy Double Mutant Seeds Fail to Mobilize TAG Because of a Block in Fatty Acid ß-Oxidation
Mutants blocked in ß-oxidation fail to mobilize TAG and are compromised in germination or seedling growth (Hayashi et al., 1998
; Germain et al., 2001
; Footitt et al., 2002
; Fulda et al., 2004
). To determine if csy double mutants can mobilize TAG, embryos were removed from dormant seeds at day 1.5 and grown for 2, 3, 4, and 5 d. The TAG content of such seedlings was determined by the quantitation of eicosenoic acid (20:1) by gas chromatographymass spectrometry. In csy double mutants, the amount of TAG does not change from day 1.5 to day 5 (Figure 6), whereas that in wild-type seedlings declines rapidly from day 2 such that it is almost absent by day 5 (Figure 6). It is not possible to identify homozygous mutant seed before 1.5 d, so we cannot determine TAG content at day 0. However, because TAG does not decline after day 1.5, and is similar in amount to that of wild-type seedlings at day 0, we assume that TAG does not decline between day 0 and day 1.5.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
In yeast, mutation of peroxisomal CSY does not prevent the respiration of fatty acids because yeast contains an acylcarnitine shuttle to transfer acetyl units to the mitochondrion for respiration (van Roermund et al., 1995
, 1999
). It was proposed that carbon from fatty acids can be transferred to the mitochondrion either as acetylcarnitine or as succinate after passage through the glyoxylate cycle (van Roermund et al., 1999
). We suggest that carbon from ß-oxidation could potentially be transferred as citrate in yeast as well as in Arabidopsis. Citrate is normally exported from the peroxisome in both yeast and plants as part of the glyoxylate cycle because aconitase is cytosolic. Such citrate or isocitrate could either be imported into mitochondria in exchange for oxaloacetate by a carboxylic acid transporter in the mitochondrial membrane (Picault et al., 2002
) or it could be metabolized by the glyoxylate cycle. It is not yet known if oxaloacetate is imported into the peroxisome to maintain CSY activity or if it is converted to aspartate before import (Mettler and Beevers, 1980
). The partitioning of citrate between the glyoxylate cycle and respiratory pathway may be determined by the relative demands for sugar or energy by the seedling.
Whereas yeast can employ the acylcarnitine shuttle, the data presented here indicate that Arabidopsis does not contain this alternative mechanism because double mutant csy seedlings are completely unable to break down their TAG. The role of BOU, the acylcarnitine carrier-like protein in the Arabidopsis mitochondrial membrane (Lawand et al., 2002
), has still to be elucidated, but our data indicate that this pathway is not responsible for a major transfer of carbon from peroxisomes to mitochondria in seedlings.
Our data support the original proposal of Raymond et al. (1992)
that peroxisomal CSY participates together with mitochondrial citric acid cycle enzymes in the respiration of acetyl units from peroxisomal fatty acid ß-oxidation. The proposed requirement for peroxisomal CSY in fatty acid ß-oxidation is consistent with the observed expression throughout the plant of CSY genes (Figure 2B) and ß-oxidation genes (Hooks, 2002
). Peroxisomal CSY activity is detected in a range of plant tissues, rather than just those in which the glyoxylate cycle is active (Cornah and Smith, 2002
). Furthermore, CSY and ß-oxidation genes increase in expression in senescing leaves, whereas glyoxylate cycle genes do not (Figure 9).
Although there are three peroxisomal CSY genes in the Arabidopsis genome, we have demonstrated that only two of these (CSY2 and 3) are active during seed germination and seedling development. Knockout mutations in each of these genes reveal that there is a substantial degree of functional overlap between the two isozymes because they only have a mild phenotype in the absence of sucrose. Indeed, a single copy of either of these genes is sufficient for normal germination and plant growth. The severe phenotype of csy2 csy3 double mutants indicates that CSY1 is unable to compensate for the lack of CSY2 and 3 in the peroxisome. This is explained by the expression of CSY1 only in siliques and specifically in developing seeds (Figure 2B, top and middle panels). Several studies have shown ß-oxidation activity in developing oilseeds (Eccleston and Ohlrogge, 1998
; Hooks, 2002
) and the acx3 acx4 double mutant has an embryo-lethal phenotype, showing the importance of ß-oxidation in seed development (Rylott et al., 2003
). We propose that the requirement for peroxisomal CSY in fatty acid ß-oxidation during seed development is fulfilled by the CSY1 isoform in csy2 csy3 double mutants.
The failure of csy2 csy3 double mutants to grow into mature plants and to flower suggests an essential role for ß-oxidation. No ß-oxidation mutants so far described are compromised to such an extent as csy2 csy3, but in all cases this can be explained by redundancy of genes (Richmond and Bleecker, 1999
; Germain et al., 2001
; Hooks, 2002
; Fulda et al., 2004
). An alternative explanation is that CoA is sequestered as acetyl-CoA in the csy2 csy3 mutant and that either the lack of free CoA or an inhibitory effect of acetyl-CoA may inhibit growth. Similar explanations have been advanced to explain resistance to indol-3-butyric acid in ACX mutants (Adham et al., 2005
).
The seed dormancy of double csy mutants may result because they are unable to produce enough energy to initiate the processes of germination. However, like the cts mutant (Footitt et al., 2002
), exogenous sucrose cannot trigger germination unless the seed coat is disrupted. This suggests that fatty acid ß-oxidation plays a role beyond that of energy or carbon provision to the germinating seed. Similarly, a block in ß-oxidation in the peroxisome prevents lipase action in the lipid body and can lead to abnormal peroxisome development (Germain et al., 2001
). All of these observations suggest a role for lipid signaling in the control of germination and metabolism. Whether this is due to ß-oxidation removing a particular signaling molecule or creating one is unknown. Nevertheless, ß-oxidation appears to provide an essential trigger for seed germination in Arabidopsis.
| METHODS |
|---|
|
|
|---|
Phylogenetic Analysis
The amino acids sequences of Arabidopsis, pumpkin (Curcurbita pepo), and Saccharomyces cerevisiae CSYs were aligned using ClustalX and then edited using Bioedit software (version 4.8.4; http://www.mbio.ncsu.edu/RNaseP/info/programs/BIOEDIT/bioedit.html). Protdist was used to calculate a distance matrix and then Neighbor was used to build a phylogentic tree (both programs part of PHYLIP software package, version 3.63; http://evolution.genetics.washington.edu/phylip.html). Bootstrap analysis was then performed with 1000 replicates using the same combination of programs.
Screening of T-DNA Insertion Lines and Isolation of csy Knockout Mutants
Arabidopsis seed lines containing T-DNA insertions in the CSY2 and 3 genes were obtained from the Syngenta SAIL collection (csy2-1, csy2-2, and csy3-1; Sessions et al., 2002
) and the SALK collection (csy3-2; Alonso et al., 2003
). PCR-based screening was used to identify individuals homozygous for T-DNA insertions in CSY2 (At3g58750) and CSY3 (At2g42790) genes. The gene-specific primers CSY2_For (5'-GTCTGATACCGTCGGATTGG-3'), CSY3_For (5'-CGGAAGGAAAACAGGATTCTCC-3'), and CSY_comRev (5'-CCAGTGTGACAAGTATCCAGC-3') were used in combination with T-DNA left border primers (Krysan et al., 1999
; Alonso et al., 2003
).
RT-PCR
RNA was isolated from seedlings using the Qiagen RNAeasy kit (Crawley, West Sussex, UK) and used to generate cDNA with either the Qiagen Omniscript or Qiagen Sensiscript RT-PCR kit. PCR was performed for 35 cycles with gene-specific primers (5'3') as follows: ACT2 (CAACCAATCGTGTGTGA and CTGTGAACGATTCCTGGA), CSY1 (CTGAGCCGAATCAGGTGTTGC and CCAGTGTGACAAGTATCCAGC), CSY2 (GTCTGATACCGTCGGATTGG and CCAGTGTGACAAGTATCCAGC), CSY3 (CGGAAGGAAAACAGGATTCTCC and CCAGTGTGACAAGTATCCAGC), CSY4 (AGCAGGACCGTCTGAAGAAA and CGGAATAACCTTGCCACTGT), LACS7 (GTATGGTGGTGTTGCTGTCG and ATGGTTCTGGCACCAAAGTC), ACOX2 (CTTCCAACTCATGATTCCAAAGGAGTC and CAGCAGCCACCTGTTGCAGAAGTACAG), MFP2 (CCTTGACATAGTCGGGAGGA and GGCATTCCAAACTTGCTGAT), KAT2 (GAGTCCATGACTACCAATCCAATGCC and CCCAAGAGAAGCAAGAGTTGTGGTTG), MLS (ATGGAGCTCGAGACCTCAGTTTATC and GAGCCTTGAGACATTGATAGGGTAG), ICL (GCAGAGGGAGGCAAGAATGAGCATG and TAACACTCGGCCTTGCTCATTTGAC).
Plasmid Construction
The plasmids used in this study are all based on the double CaMV 35S promoter and CaMV terminator cassette inserted into the pGreen binary vector p0179, which confers hygromycin resistance, except p35S:mRFP-SRL, which was cloned into pGreen0045, which confers kanamycin resistance (Hellens et al., 2000
). A CSY3 cDNA was obtained from Riken (pda02633 Seki et al., 2002
) and subcloned within the CaMV cassette to generate p35S:CSY3. A modified CSY3 cDNA was generated in which the first 60 bases, corresponding to the PTS2 signal sequence, were deleted and a PTS1 sequence, corresponding to the last 10 amino acids of the pumpkin MLS gene (Hayashi et al., 1996
; Lin et al., 2004
) were fused at the 3' end. This construct was called p35S:
CSY3-SRL.
GFP constructs p35S:CSY2-GFP and p35S:CSY3-GFP were generated by fusing the leader sequence, corresponding to the first 44 and 40 amino acids of CSY2 and CSY3, respectively, to the coding sequence for GFP and subcloning these fragments into the CaMV cassette. A peroxisomally targeted mRFP construct, p35S:mRFP-SRL, was generated by addition of the pumpkin MLS PTS1 sequence at the 3' end. The fragment was subcloned into the CaMV cassette and cloned into pGreen0045.
Arabidopsis Transformation
The plasmid constructs were transfected in Agrobacterium tumefaciens strain GV3101 (Koncz and Schell, 1986
), and Arabidopsis was subjected to transformation by the floral dip method (Clough and Bent, 1998
). Seed collected from dipped plants was screened on the appropriate antibiotic and resistant seedlings selected and verified by PCR.
Microscopy
Confocal microscopy was performed to observe GFP and mRFP in root hair cells as previously described (Lin et al., 2004
). For transmission electron microscopy, cotyledons from seedlings germinated for 5 d on half-strength MS medium supplemented with 1% (w/v) sucrose were processed as previously described (Germain et al., 2001
)
Biochemical Analysis
For enzyme assays, tissue extracts were prepared from Arabidopsis seedlings, and CSY activity was assayed as described (Kato et al., 1995
).
Protein content was determined as reported (Bradford, 1976
) using BSA as the standard. Total fatty acids were extracted and quantified by gas chromatographymass spectrometry (Browse et al., 1986
) using C20:1 as a marker for TAG.
Arabidopsis Genome Initiative numbers of the five putative CSY sequences from Arabidopsis are At3g58740, At3g58750, At2g42790, At2g44350, and At3g60100. The CSY gene name has been registered with The Arabidopsis Information Resource.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: School of Biomedical and Chemical Sciences, University of Western Australia, 35 Stirling Highway, Crawley, WA 6009, Australia. ![]()
The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantcell.org) is: Steven M. Smith (ssmith{at}cyllene.uwa.edu.au).
Online version contains Web-only data. ![]()
Article, publication date, and citation information can be found at www.plantcell.org/cgi/doi/10.1105/tpc.105.031856.
Received February 16, 2005; Revision received April 7, 2005. accepted April 7, 2005.
| REFERENCES |
|---|
|
|
|---|
Alonso, J.M., al. (2003). Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653657.
Boyes, D.C., Zayed, A.M., Ascenzi, R., McCaskill, A.J., Hoffman, N.E., Davis, K.R., and Gorlach, J. (2001). Growth stage-based phenotypic analysis of Arabidopsis: A model for high throughput functional genomics in plants. Plant Cell 13, 14991510.
Bradford, M.M. (1976). A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye-binding. Anal. Biochem. 72, 248254.[CrossRef][ISI][Medline]
Browse, J., McCourt, P.J., and Somerville, C.R. (1986). Fatty-acid composition of leaf lipids determined after combined digestion and fatty-acid methyl-ester formation from fresh tissue. Anal. Biochem. 152, 141145.[CrossRef][ISI][Medline]
Clough, S.J., and Bent, A.F. (1998). Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735743.[CrossRef][ISI][Medline]
Cornah, J.E., Germain, V., Ward, J.L., Beale, M.H., and Smith, S.M. (2004). Lipid utilization, gluconeogenesis, and seedling growth in Arabidopsis mutants lacking the glyoxylate cycle enzyme malate synthase. J. Biol. Chem. 279, 4291642923.
Cornah, J.E., and Smith, S.M. (2002). Synthesis and function of glyoxylate cycle enzymes. In Plant Peroxisomes, A. Baker and I.A. Graham, eds (London: Kluwer Academic Publishers), pp. 57101.
Courtois-Verniquet, F., and Douce, R. (1993). Lack of aconitase in glyoxysomes and peroxisomes. Biochem. J. 294, 103107.
De Bellis, L., Hayashi, M., Biagi, P.P., Haranishimura, I., Alpi, A., and Nishimura, M. (1994). Immunological analysis of aconitase in pumpkin cotyledons: The absence of aconitase in glyoxysomes. Physiol. Plant. 90, 757762.[CrossRef]
Dieuaide, M., Brouquisse, R., Pradet, A., and Raymond, P. (1992). Increased fatty acid ß-oxidation after glucose starvation in maize root tips. Plant Physiol. 99, 595600.
Eastmond, P.J., Germain, V., Lange, P.R., Bryce, J.H., Smith, S.M., and Graham, I.A. (2000). Postgerminative growth and lipid catabolism in oilseeds lacking the glyoxylate cycle. Proc. Natl. Acad. Sci. USA 97, 56695674.
Eastmond, P.J., and Graham, I.A. (2001). Re-examining the role of glyoxylate cycle in oilseeds. Trends Plant Sci. 6, 7277.[CrossRef][ISI][Medline]
Eccleston, V.S., and Ohlrogge, J.B. (1998). Expression of lauroyl-acyl carrier protein thioesterase in Brassica napus seeds induces pathways for both fatty acid oxidation and biosynthesis and implies a set point for triacylglycerol accumulation. Plant Cell 10, 613622.
Elgersma, Y., Van Roermund, C.W.T., Wanders, R.J.A., and Tabak, H.F. (1995). Peroxisomal and mitochondrial carnitine acetyltransferases of Saccharomyces cerevisiae are encoded by a single gene. EMBO J. 14, 34723479.[ISI][Medline]
Footitt, S., Slocombe, S.P., Larner, V., Kurup, S., Wu, Y., Larson, T., Graham, I., Baker, A., and Holdsworth, M. (2002). Control of germination and lipid mobilization by COMATOSE, the Arabidopsis homologue of human ALDP. EMBO J. 21, 29122922.[CrossRef][ISI][Medline]
Fulda, M., Schnurr, J., Abbadi, A., Heinz, E., and Browse, J. (2004). Peroxisomal acyl-CoA synthetase activity is essential for seedling development in Arabidopsis thaliana. Plant Cell 16, 394405.
Germain, V., Rylott, E.L., Larson, T.R., Sherson, S.M., Bechtold, N., Carde, J.P., Bryce, J.H., Graham, I.A., and Smith, S.M. (2001). Requirement for 3-ketoacyl-CoA thiolase-2 in peroxisome development, fatty acid ß-oxidation and breakdown of triacylglycerol in lipid bodies of Arabidopsis seedlings. Plant J. 28, 112.[CrossRef][ISI][Medline]
Hayashi, M., De Bellis, L., Alpi, A., and Nishimura, M. (1995). Cytosolic aconitase participates in the glyoxylate cycle in etiolated pumpkin cotyledons. Plant Cell Physiol. 36, 669680.
Hayashi, M., Masahiro, A., Kato, A., Kondo, M., and Nishimura, M. (1996). Transport of chimeric proteins that contain a carboxy-terminal targeting signal into plant microbodies. Plant J. 10, 225234.[CrossRef][ISI][Medline]
Hayashi, M., Nito, K., Takei-Hoshi, R., Yagi, M., Kondo, M., Suenaga, A., Yamaya, T., and Nishimura, M. (2002). Ped3p is a peroxisomal ATP-binding cassette transporter that might supply substrates for fatty acid ß-oxidation. Plant Cell Physiol. 43, 111.
Hayashi, M., Toriyama, K., Kondo, M., and Nishimura, M. (1998). 2,4-Dichlorophenoxybutyric acid-resistant mutants of Arabidopsis have defects in glyoxysomal fatty acid ß-oxidation. Plant Cell 10, 183195.
Heazlewood, J.L., Tonti-Filippini, J.S., Gout, A.M., Day, D.A., Whelan, J., and Millar, A.H. (2004). Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. Plant Cell 16, 241256.
Hellens, R.P., Edwards, E.A., Leyland, N.R., Bean, S., and Mullineaux, P.M. (2000). pGreen: A versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 42, 819832.[CrossRef][ISI][Medline]
Hooks, M.A. (2002). Molecular biology, enzymology, and physiology of ß-oxidation. In Plant Peroxisomes, A. Baker and I.A. Graham, eds (London: Kluwer Academic Publishers), pp.1955.
Hooks, M.A., Bode, K., and Couée, I. (1995). Regulation of acyl-CoA oxidases in maize seedlings. Phytochemistry 40, 657660.[CrossRef]
Kato, A., Hayashi, M., Kondo, M., and Nishimura, M. (1996). Targeting and processing of a chimeric protein with the N-terminal presequence of the precursor to glyoxysomal citrate synthase. Plant Cell 8, 16011611.[Abstract]
Kato, A., Hayashi, M., Mori, H., and Nishimura, M. (1995). Molecular characterization of a glyoxysomal citrate synthase that is synthesized as a precursor of higher molecular mass in pumpkin. Plant Mol. Biol. 27, 377390.[CrossRef][ISI][Medline]
Koncz, C., and Schell, J. (1986). The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204, 383396.[CrossRef][ISI]
Krysan, P.J., Young, J.C., and Sussman, M.R. (1999). T-DNA as an insertional mutagen in Arabidopsis. Plant Cell 11, 22832290.
Kunau, W.H., Dommes, V., and Schulz, H. (1995). ß-Oxidation of fatty acids in mitochondria, peroxisomes and bacteria: A century of continued progress. Prog. Lipid Res. 34, 267342.[CrossRef][ISI][Medline]
Lawand, S., Dorne, A.J., Long, D., Coupland, G., Mache, R., and Carol, P. (2002). Arabidopsis A BOUT DE SOUFFLE, which is homologous with mammalian carnitine acyl carrier, is required for postembryonic growth in the light. Plant Cell 14, 21612173.
Lee, J.G., Cho, S.P., Lee, H.S., Lee, C.H., Bae, K.S., and Maeng, P.J. (2000). Identification of a cryptic N-terminal signal in Saccharomyces cerevisiae peroxisomal citrate synthase that functions in both peroxisomal and mitochondrial targeting. J. Biochem. (Tokyo) 128, 10591072.
Lin, Y., Cluette-Brown, J.E., and Goodman, H.M. (2004). The peroxisome deficient Arabidopsis mutant sse1 exhibits impaired fatty acid synthesis. Plant Physiol. 135, 814827.
Mettler, I.J., and Beevers, H. (1980). Oxidation of NADH in glyoxysomes by a malate-aspartate shuttle. Plant Physiol. 66, 555560.
Picault, N., Palmieri, L., Pisano, I., Hodges, M., and Palmieri, F. (2002). Identification of a novel transporter for dicarboxylates and tricarboxylates in plant mitochondria. Bacterial expression, reconstitution, functional characterization, and tissue distribution. J. Biol. Chem. 277, 2420424211.
Raymond, P., Spiteri, A., Dieuaide, M., Gerhardt, B., and Pradet, A. (1992). Peroxisomal ß-oxidation of fatty acids and citrate formation by a particulate fraction from early germinating sunflower seeds. Plant Physiol. Biochem. 30, 153161.[ISI]
Richmond, T., and Bleecker, A.B. (1999). A defect in ß-oxidation causes abnormal inflorescence development in Arabidopsis. Plant Cell 11, 19111924.
Russell, L., Larner, V., Kurup, S., Bougourd, S., and Holdsworth, M. (2000). The Arabidopsis COMATOSE locus regulates germination potential. Development 127, 37593767.[Abstract]
Rylott, E.L., Rogers, C.A., Gilday, A.D., Edgell, T., Larson, T.R., and Graham, I.A. (2003). Arabidopsis mutants in short- and medium-chain acyl-CoA oxidase activities accumulate acyl-CoAs and reveal that fatty acid ß-oxidation is essential for embryo development. J. Biol. Chem. 278, 2137021377.
Schnarrenberger, C., Fitting, K.H., Tetour, M., and Zehler, H. (1980). Inactivation of the glyoxysomal citrate synthase from caster bean endosperm by 5,5'-dithio-bis(2-nitrobenzoic acid) (DTNB). Protoplasma 103, 299307.[CrossRef]
Seki, M., et al. (2002). Functional annotation of a full-length Arabidopsis cDNA collection. Science 296, 141145.
Sessions, A., et al. (2002). A high-throughput Arabidopsis reverse genetics system. Plant Cell 14, 29852994.
Sherson, S.M., Hemmann, G., Wallace, G., Forbes, S., Germain, V., Stadler, R., Bechtold, N., Sauer, N., and Smith, S.M. (2000). Monosaccharide/proton symporter AtSTP1 plays a major role in uptake and response of Arabidopsis seeds and seedlings to sugars. Plant J. 24, 849857.[CrossRef][ISI][Medline]
van Roermund, C.W.T., Elgersma, Y., Singh, N., Wanders, R.J.A., and Tabak, H.F. (1995). The membrane of peroxisomes in Saccharomyces cerevisiae is impermeable to NAD(H) and acetyl-CoA under in vivo conditions. EMBO J. 14, 34803486.[ISI][Medline]
van Roermund, C.W.T., Hettema, E.H., van den Berg, M., Tabak, H.F., and Wanders, R.J.A. (1999). Molecular characterisation of carnitine-dependent transport of acetyl-CoA from peroxisomes to mitochondria in Saccharomyces cerevisiae and identification of a plasma membrane carnitine transporter, Agp2p. EMBO J. 18, 58435852.[CrossRef][ISI][Medline]
Zolman, B.K., Silva, I.D., and Bartel, B. (2001). The Arabidopsis pxa1 mutant is defective in an ATP-binding cassette transporter-like protein required for peroxisomal fatty acid ß-oxidation. Plant Physiol. 127, 12661278.
Related articles in Plant Cell:
This article has been cited by other articles:
![]() |
B. S. Zheng, E. Ronnberg, L. Viitanen, T. A. Salminen, K. Lundgren, T. Moritz, and J. Edqvist Arabidopsis sterol carrier protein-2 is required for normal development of seeds and seedlings J. Exp. Bot., September 1, 2008; 59(12): 3485 - 3499. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sienkiewicz-Porzucek, A. Nunes-Nesi, R. Sulpice, J. Lisec, D. C. Centeno, P. Carillo, A. Leisse, E. Urbanczyk-Wochniak, and A. R. Fernie Mild Reductions in Mitochondrial Citrate Synthase Activity Result in a Compromised Nitrate Assimilation and Reduced Leaf Pigmentation But Have No Effect on Photosynthetic Performance or Growth Plant Physiology, May 1, 2008; 147(1): 115 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Strijbis, C. W. T. van Roermund, W. F. Visser, E. C. Mol, J. van den Burg, D. M. MacCallum, F. C. Odds, E. Paramonova, B. P. Krom, and B. Distel Carnitine-Dependent Transport of Acetyl Coenzyme A in Candida albicans Is Essential for Growth on Nonfermentable Carbon Sources and Contributes to Biofilm Formation Eukaryot. Cell, April 1, 2008; 7(4): 610 - 618. [Abstract] [Full Text] [PDF] |
||||