|
|
||||||||
|
First published online October 13, 2006; 10.1105/tpc.106.042226 The Plant Cell 18:2608-2621 (2006) © 2006 American Society of Plant Biologists
Retention of a Bean Phaseolin/Maize
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
-zein forms ER-located PBs. Zeolin has 6 Cys residues and, like
-zein with 15 residues, is insoluble unless reduced. The contribution of disulfide bonds to zeolin destiny was determined by studying in vivo the effects of 2-mercaptoethanol (2-ME) and by zeolin mutagenesis. We show that in tobacco (Nicotiana tabacum) protoplasts, 2-ME enhances interactions of newly synthesized proteins with the ER chaperone BiP and inhibits the secretory traffic of soluble proteins with or without disulfide bonds. In spite of this general inhibition, 2-ME enhances the solubility of zeolin and relieves its retention in the ER, resulting in increased zeolin traffic. Consistently, mutated zeolin unable to form disulfide bonds is soluble and efficiently enters the secretory traffic without 2-ME treatment. We conclude that disulfide bonds that lead to insolubilization are a determinant for PB-mediated protein accumulation in the ER. | INTRODUCTION |
|---|
|
|
|---|
PBs are heteropolymers composed of the products of gene families. Prolamins have variable structures, but they share the common property of being soluble in water mixed with a high percentage of alcohol. In many cases, they contain a repetitive domain (made of building blocks that are not conserved between the different prolamins) inserted within other regions that are rich in Cys residues (Shewry and Halford, 2002
). The latter contain domains homologous with those of the 2S storage albumins abundant in oil seeds, which are water-soluble, monomeric vacuolar storage proteins (Shewry et al., 1995
). The Cys residues of prolamins form intrachain and often interchain disulfide bonds, most likely contributing to PB assembly.
The expression of individual prolamin genes in vegetative tissues can lead to the formation of PBs, indicating that PB assembly and retention does not require cereal seedspecific ER proteins other than the prolamins themselves (Geli et al., 1994
; Bagga et al., 1995
). Accumulation of different prolamins in transgenic plants is polypeptide-specific and indicates that certain polypeptides are more important than others for the formation of a stable PB (Coleman et al., 1996
; Bagga et al., 1997
). The prolamins of maize are divided into four groups:
-, ß-,
-, and
-zein, the most abundant being the
-zeins, followed by
-zein. At the end of seed maturation, the central part of the PB is mainly occupied by
-zeins, whereas
-zein is located peripherally (Lending and Larkins, 1989
). However, the synthesis of
- and ß-zein starts earlier than that of the other zein classes during maize seed development, and coexpression experiments in transgenic tobacco (Nicotiana tabacum) indicate that
- and ß-zein have a stabilizing effect on
- and
-zein, respectively (Lending and Larkins, 1989
; Coleman et al., 1996
; Bagga et al., 1997
). Therefore,
-zein seems to be a fundamental protein for maize PB biogenesis.
We have expressed in tobacco a fusion between the 7S vacuolar storage protein of Phaseolus vulgaris, phaseolin, and approximately the first half of
-zein (Mainieri et al., 2004
). The zein portion includes the repeated region and 6 of the total 15 Cys residues, excludes the domains homologous with the 2S albumins, and has been shown in deletion experiments to be able to accumulate in the ER (Geli et al., 1994
; Shewry et al., 1995
). Phaseolin does not contain Cys residues and is a soluble trimeric globulin. The fusion protein, termed zeolin, has the solubility and assembly properties of
-zein: it is insoluble unless its disulfide bonds are reduced, and it forms PBs in the ER (Mainieri et al., 2004
). Therefore, zeolin is a good model to analyze PB formation within the plant ER, focusing on the repeated domain and a limited number of Cys residues. In this study, we have investigated the role played by disulfide bonds in the ER retention of zeolin by studying the in vivo effect of the reducing agent 2-mercaptoethanol (2-ME) and by zeolin mutagenesis.
| RESULTS |
|---|
|
|
|---|
45 kD) at the end of the pulse, and typical vacuolar fragmentation products were formed during the chase (Figure 1A
, lanes 1 and 2). Inclusion of 2 or 20 mM 2-ME in the protoplast incubation medium at the beginning of the chase partially inhibited the formation of vacuolar fragments, and this effect was more marked at higher concentrations (Figure 1, lanes 3 and 4). Treatment with the much stronger dithiol reducing agent DTT leads to an even greater inhibition of vacuolar fragmentation (data not shown). When protoplasts were pretreated with 20 mM 2-ME and the reducing agent was maintained during labeling, there was a dramatic inhibition of protein synthesis (Klein et al., 2006
|
The microsomal fraction contains ER and the Golgi complex as major components of the endomembrane system. To acquire more information on the compartment where the block in traffic occurs, we took advantage of the fact that the single oligosaccharide chain of T343F phaseolin is modified into a complex structure in the Golgi complex (Frigerio et al., 1998
). N-linked oligosaccharide chains added to glycoproteins within the ER can be removed in vitro from the polypeptide chain by the enzyme endoglycosidase H, but extensive modifications by Golgi enzymes confer resistance to the glycosidase. T343F phaseolin accumulated in the microsomal fraction of protoplasts treated with 2-ME is for the most part susceptible to digestion by endoglycosidase H (Figure 1B, lanes 7 and 8), indicating that most polypeptides are still located in the ER or the cis-cisternae of the Golgi complex after 6 h of chase.
To investigate whether 2-ME also inhibits the traffic of secreted proteins, we analyzed its effect on
418 phaseolin, a mutated form that does not contain the vacuolar sorting signal and is efficiently secreted from protoplasts of transgenic tobacco (Frigerio et al., 1998
). A concentration of 20 mM 2-ME partially inhibited the secretion of
418 phaseolin, which remained detectable in protoplast extracts even after 24 h of chase (Figure 1C). Similarly, intact T343F polypeptides were also detectable after 24 h of chase in the presence of 20 mM 2-ME (data not shown). However, it should be noted that secretion of
418 was less severely inhibited than vacuolar delivery of T343F phaseolin, particularly during the first hour of chase.
We conclude that 20 mM 2-ME strongly inhibits the traffic of phaseolin, causing mainly accumulation in the ER or cis-Golgi cisternae, and that the inhibitory effect is more marked on the vacuolar sorting machinery.
2-ME Inhibits the Release of Newly Synthesized Polypeptides from BiP
Reducing agents perturb the proper folding of a number of newly synthesized polypeptides that emerge into the ER (Braakman et al., 1992
; Tatu et al., 1993
). This could result in prolonged interactions with ER chaperones such as BiP (Jämsä et al., 1994
; Ben-Zeev et al., 2002
). Association with BiP is part of the quality-control mechanism that prevents the intracellular traffic of protein folding and assembly intermediates and of defective, misfolded proteins (Sitia and Braakman, 2003
). Therefore, we investigated whether 2-ME alters the association of newly synthesized polypeptides with BiP. Protoplasts prepared from wild-type tobacco leaves were subjected to pulsechase, and proteins were immunoprecipitated with anti-BiP antiserum. As reported previously (Crofts et al., 1998
), in normal conditions many newly synthesized tobacco polypeptides were coimmunoprecipitated with BiP after 1 h of pulse-labeling but not after the subsequent chase points, reflecting the expected physiological transient association with the chaperone (Figure 2
, lanes 1 to 4). In the presence of 2-ME, this association was dramatically extended in time (Figure 2, lanes 5 to 7). The qualitative SDS-PAGE banding pattern of BiP-coimmunoprecipitated polypeptides was not markedly altered by 2-ME, except for the intense band of <30 kD. However, unlike the other radioactive polypeptides, this component was resistant to in vitro release from BiP by ATP treatment, suggesting peculiar interactions (see Supplemental Figure 1 online). We conclude that 2-ME markedly slows the release from BiP of many natural transient ligands of this chaperone.
|
|
|
95 and 45 kD, detected after long gel exposure (asterisk and arrow in Figure 3C). These are very minor radioactive components with respect to intracellular zeolin. Polypeptides with very similar molecular masses are detected by protein blot of total leaf proteins; also in that case, they represent a very minor proportion of total zeolin (Mainieri et al., 2004
-zein expressed in leaves of transgenic Arabidopsis also suggested the hydroxylation of Pro residues (Geli et al., 1994The effect of 2-ME on the solubility, traffic, and processing of zeolin was next determined. The reducing agent was included in the protoplast incubation medium during the chase but not in the homogenation buffer. 2-ME increased the solubility of intact zeolin during the chase (Figures 4A and 4B, cf. zeolin in protoplasts at the different chase points in the presence and absence of 2-ME). In the experiment shown in Figure 4A, the major effect on the pattern of zeolin processing and traffic was a marked increase in the secretion of the 45-kD processed form. A polypeptide with the same molecular mass became detectable also intracellularly during the chase, probably representing the intermediate of secretion. In several repetitions of this experiment, we consistently observed a marked increase of zeolin solubility during the chase in the presence of 2-ME. In some experiments, the increase in secretion of the 45-kD form was less marked, whereas the secreted 95-kD form and/or phaseolin vacuolar fragments became more abundant (Figure 4B). Protein blot analysis of protoplasts and incubation medium confirmed the pulsechase results: after 24 h of treatment with 2-ME, the 45- and 95-kD forms clearly accumulated in the incubation medium (Figure 5 , cf. lanes 7 and 8).
|
|
We interpret the data shown in Figures 3 to 6![]()
to indicate that 2-ME inhibits the insolubilization of zeolin and relieves its ER retention, leading to increased release of 45-kD phaseolin polypeptides that are either secreted or sorted to the vacuole, with a variable balance between the two destinies, and secretion of the 95-kD form. We conclude that, in the case of zeolin, the general partial inhibitory effect of 2-ME on the secretory pathway is overcome by the increase in solubility that makes the polypeptides competent for traffic. This finding suggests a role of disulfide bonds in the retention of zeolin within the ER, which was further investigated by mutagenesis of the Cys codons.
Mutated Zeolin Devoid of Cys Residues Is Secreted
The six Cys codons of zeolin were mutated to Ser codons to study the destiny of a zeolin mutant unable to form disulfide bonds. The mutated zeolin sequence, termed zeolin(Cys) was transiently expressed in tobacco protoplasts. Transfections with the empty plasmid or with plasmid encoding unmodified zeolin were used as controls. After pulsechase labeling, protoplasts and incubation medium were homogenized in the presence (Figures 7A
, incubation medium, and 7B) or absence (Figure 7A, protoplasts) of 2-ME and the homogenates were immunoprecipitated with anti-phaseolin antiserum. Transiently transfected protoplasts produce on average a lower amount of foreign protein than transgenic protoplasts, because of the inefficiency of the transfection procedure. As a result, contamination of immunoprecipitates by endogenous tobacco polypeptides is quite marked. This is illustrated by transfection with the empty plasmid (Figure 7, control). Most zeolin is already insoluble at the end of the pulse because of disulfide bond formation; it then becomes almost fully insoluble during the chase and is secreted in very small amounts (Figures 7A and 7B, arrowheads; note that immunoprecipitations were performed on equal aliquots of protoplast homogenates but that the fluorograph in B was exposed for half of the time with respect to that in A). This finding indicates a very similar zeolin destiny in transiently transfected and transgenic protoplasts. Zeolin(Cys) does not become insoluble (Figures 7A and 7B, arrowheads) and is mostly processed into secreted phaseolin (arrow) during the chase. Therefore, Cys residues are responsible for the insolubility of zeolin and its inability to enter traffic along the secretory pathway. The secreted, high molecular mass form of zeolin was not detectable in the pulsechase results shown in Figure 7, but it was detectable in other repetitions of the same experiment (data not shown), again indicating that there is a subtle balance between proteolytic cleavage and other forms of posttranslational processing once zeolin enters traffic.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
-zein, which has the same solubility properties and ability to form PBs of zeolin.
Zeolin solubilization and traffic are only partially stimulated by 20 mM 2-ME, probably because of the partial resistance of disulfide bonds to the reducing agent. Experiments with further increased concentrations of 2-ME or with the much more potent agent DTT, in an effort to increase the solubilization of zeolin, would be difficult to interpret, because of the severe effects on protoplast viability (Piñeiro et al., 1994
; our unpublished results). We cannot exclude a possible additional role of other mechanisms (such as interactions of the zein repetitive domain with membrane lipids; see below) in zeolin ER retention, but the destiny of zeolin(Cys) in transiently transfected protoplasts assigns a major role to disulfide bonds. A model that takes into account our results is shown in Figure 10
.
|
-factor and invertase was not affected by treatment with 20 mM DTT (Jämsä et al., 1994
1-antitrypsin (which is also devoid of disulfide bonds) by human hepatoma cells is only marginally inhibited by 2 mM DTT (Lodish and Kong, 1993
When cells are treated with reducing agents, the newly synthesized polypeptides of a number of mammalian or yeast secretory proteins that normally contain disulfide bonds increase their association with BiP and other ER chaperones (Jämsä et al., 1994
; Ben-Zeev et al., 2002
) and can form heterotypic aggregates excluding proteins that normally are devoid of disulfide bonds (Sawyer et al., 1994
). Interactions with chaperones and the formation of large aggregates could in turn determine the inhibitory effect on intracellular traffic. Consistently, we have shown that 2-ME enhances the interactions of many tobacco newly synthesized polypeptides with BiP. However, this relatively simple explanation cannot hold for phaseolin. Therefore, it is likely that a reduction of one or more factors of the machinery necessary for protein folding and traffic causes its loss of function, with a cascade of effects that inhibit traffic and sorting along the plant secretory pathway, independent of the disulfide requirements of individual passenger proteins. The effect is more marked on vacuolar sorting; in this respect, it should be emphasized that the basic mechanisms of protein traffic are conserved in eukaryotes, but the different kingdoms have a number of distinct features, particularly in the traffic to the inner hydrolytic compartments (Jürgens, 2004
; Vitale and Hinz, 2005
).
Disulfide Bonds Play a Role in Zeolin Accumulation in the ER
The expression of a number of deletion mutants of
-zein in Arabidopsis thaliana indicates that the N-terminal region, containing the repetitive domain, is fundamental for ER retention, whereas the C-terminal region is necessary for assembly into PBs (Geli et al., 1994
). Our studies on zeolin indicate that the C-terminal region, which contains the domains homologous with the 2S albumins, is indeed not strictly necessary for PB formation (Mainieri et al., 2004
). A synthetic version of the eight VHLPPP repeats of the
-zein N-terminal region forms an amphipathic polyproline II structure and interacts with liposomes prepared with soybean (Glycine max) phosphatidylcholine, suggesting that this repeat may directly associate with the ER membrane in vivo (Kogan et al., 2004
). This is consistent with the accumulation of
-zein at the periphery of the PBs, in apparent contact with the ER membrane (Lending and Larkins, 1989
). The interactions with membrane lipids could contribute to ER retention. However, the N-terminal region also contains six Cys residues, and we showed that disulfide bonds are necessary for zeolin polymerization and insolubilization (Mainieri et al., 2004
). We show here that 2-ME or mutagenesis of the Cys codons enhances the in vivo solubility of zeolin and increases the secretion or vacuolar sorting of the phaseolin portion of zeolin. The release of phaseolin trimers from zeolin also occurs, to a much more limited extent, in normal conditions and is inhibited by the presence of BFA, indicating that it requires traffic (Mainieri et al., 2004
). Consistently, the 2-MEmediated secretion of the released phaseolin is also inhibited by BFA. The repartition between secretion and vacuolar delivery of the released phaseolin varies between different experiments, possibly because of variability in the maintenance of the vacuolar sorting signal after zeolin cleavage. 2-ME and mutagenesis also induce the increased formation and secretion of a 95-kD form of zeolin, which is probably O-glycosylated during traffic through the Golgi complex. Our results indicate that disulfide bonds between the Cys residues present in zeolin play an important role in the retention of the fusion protein within the ER, possibly because of their fundamental role in zeolin polymerization.
Zeolin solubilized in vivo by 2-ME interacts with BiP but becomes available for traffic. Because the amount of BiP-associated zeolin that we detect during the chase points is a very small proportion of total zeolin, we cannot rule out the possibility that it represents a subset of misfolded molecules that will remain unavailable for traffic. However, the results indicate that release from BiP is not the major limiting step in the 2-MEinduced traffic of zeolin molecules.
Comparison with Other Systems
Our results complement and extend a number of studies on the disulfide bondmediated retention of specific proteins in the ER. Rice
-globulin is a vacuolar storage protein with the typical A, B, and C domains of seed storage proteins of the 2S albumin class. 2S albumins are soluble monomeric proteins that contain four conserved intrachain disulfide bonds and are deposited into storage vacuoles (Shewry et al., 1995
). Mutations of individual Cys codons of
-globulin make orphan Cys residues available for interchain interactions in transgenic rice and cause its mistargeting to ER PBs, indicating that interchain disulfide bonds can inhibit intracellular traffic and induce incorporation into at least preexisting PBs (Kawagoe et al., 2005
). The ABC domains are also present in many prolamins, which thus seem to have evolved by the insertion of a repetitive domain within the albumin sequence (Shewry et al., 1995
). In
-zein, the ABC domains constitute the C-terminal region, which is not included in zeolin and has nine Cys residues: eight of them possibly form the typical intrachain bonds of 2S albumins; theoretically, the additional residue can be involved in zein polymerization, but it is clearly disposable for PB formation, at least in the zeolin construct.
The role of disulfide bonds in the sorting of regulated secretory proteins of mammalian cells has been investigated extensively. In endocrine, neuroendocrine, and exocrine cells, these proteins are stored in post-Golgi secretory granules that secrete their content only upon stimulation. The cell biology of these proteins has attracted the interest of researchers who study seed storage proteins, because the formation of highly condensed polymers has a role in sorting into secretory granules (Arvan et al., 2002
; Vitale and Hinz, 2005
). Unstimulated secretion of newly synthesized chromogranin B was observed in PC-12 nerve cells treated with DTT, implying a role of disulfide bonds in the sorting into secretory granules and therefore in preventing default secretion (Chanat et al., 1993
; Gorr et al., 1999
). However, this is not a general feature of regulated secretion, because treatment with reducing agents differentially affects the traffic and sorting of regulated secretory proteins, depending on both the individual protein and the cell type (Gorr et al., 1999
).
Finally, immunoglobulins are a well-characterized example of how disulfide interactions can prevent the traffic of secretory proteins. Exposed free Cys residues mediate the ER retention of the assembly intermediates of tetrameric IgG and polymeric IgA and IgM (Guenzi et al., 1994
; Valetti and Sitia, 1994
; Reddy et al., 1996
). This is a form of ER quality control: the key element in the retention mechanism is the thiol-containing ER resident protein ER p44, but other residents forming the so-called ER matrix are probably also involved (Anelli et al., 2003
). Treatment with 2-ME relieves this retention and leads to the enhanced secretion of unassembled light chains and partially assembled IgA and IgM, whereas the much more potent reducing agent DTT causes the reduction of both interchain and intrachain disulfide bonds, leading to misfolding that enhances instead of relieves ER retention, probably because of stronger interactions of exposed domains with chaperones such as BiP (Guenzi et al., 1994
; Valetti and Sitia, 1994
; Reddy et al., 1996
). We have shown here that 2-ME inhibits the traffic and assembly of IgA/G and inhibits instead of enhances the secretion of light chains, again indicating that the plant secretory pathway is more sensitive than that of mammalian cells to reducing agents.
The examples described above indicate that at different steps of the secretory pathway, interchain disulfide bonds either between specific passenger proteins or between these and the folding machinery can lead to the retention of protein in the ER or in specialized secretory granules. We have shown that disulfide bonds also play a role in the formation and ER retention of plant PBs, structures that are formed by proteins that do not have counterparts in other eukaryotes.
| METHODS |
|---|
|
|
|---|
418 phaseolin (Frigerio et al., 1998
For transient protein expression, protoplasts were isolated from small leaves of wild-type tobacco SR1 plants grown in axenic conditions and subjected to polyethylene glycolmediated transfection as described (Pedrazzini et al., 1997
) using 80 µg of plasmid. After overnight recovery, protoplasts were subjected to pulsechase labeling as described above.
Protoplast Homogenation, Protein Immunoselection, and Protein Blotting
Homogenization of the protoplast incubation medium was performed by adding to frozen samples 2 volumes of ice-cold 1.5x protoplast homogenation buffer (150 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1.5 mM EDTA, 1.5% Triton X-100, and Complete protease inhibitor cocktail [Roche]) supplemented with 4% (v/v) 2-ME. Homogenation of protoplasts was performed similarly using homogenation buffer supplemented or not with 2-ME. Proteins were immunoselected as described (Pedrazzini et al., 1997
) using rabbit polyclonal antisera against phaseolin purified from bean (Phaseolus vulgaris) seeds, recombinant tobacco BiP (Pedrazzini et al., 1997
), or rabbit anti-mouse IgG (Sigma-Aldrich). For immunoprecipitation in reducing conditions, the immunoprecipitation buffer was supplemented with 4% 2-ME. Samples were analyzed by SDS-PAGE and fluorography using 15% acrylamide gels followed by fluorography. The sample denaturation buffer for SDS-PAGE always contained 4% 2-ME, except for electrophoresis in nonreducing conditions. Gels were treated with 2,5-diphenyloxazole dissolved in DMSO and dried. Rainbow 14C-methylated proteins (Sigma-Aldrich) were used as molecular mass markers.
For protein blotting, 500,000 protoplasts were incubated for 24 h in the presence or absence of 20 mM 2-ME, and the incubation medium was then removed and stored at 80°C. Protoplasts were washed with 500 µL of W5 medium, collected by centrifugation for 10 min at 60g and 4°C, and stored at 80°C. Incubation media and pelleted protoplasts were homogenated at 4°C with denaturation buffer for SDS-PAGE and analyzed by SDS-PAGE and protein blot using anti-phaseolin antiserum (1:5000 dilution) and the Super-Signal West Pico chemiluminescent substrate (Pierce Chemical).
Subcellular Fractionation and Endoglycosidase H Digestion
For subcellular fractionation, immediately after labeling, protoplast pellets were resuspended in 350 µL of buffer B (100 mM Tris-HCl, pH 7.6, 10 mM KCl, and 1 mM EDTA) supplemented with 12% (w/w) sucrose and homogenized by pipetting the resuspension 30 times through a Gilson 200-µL tip. The homogenate was loaded on top of 300 µL of buffer B supplemented with 17% (w/w) sucrose and centrifuged in a Beckman SW 55 Ti rotor (5- x 41-mm tubes) at 150,000g for 30 min at 4°C. Pellets (microsomes) and the 12% sucrose supernatants (soluble proteins) were diluted in protoplast homogenization buffer and immunoprecipitated as described above. Digestion with endoglycosidase H was performed using endo Hf (New England Biolabs; see the manufacturer's specifications for the compositions of storage, denaturing, and reaction buffers). After phaseolin immunoselection, the protein ASepharose beads were washed twice with ice-cold water and resuspended in 50 µL of endoglycosidase H denaturing buffer. The resuspension was denatured for 10 min at 90°C. Five microliters of 10x reaction buffer was added, and the solution was divided into two equal aliquots: one was treated with 200 IUB milliunits of endo Hf, and the other (control) was supplemented with an equal volume of endo Hf storage buffer. Incubation was for 1 h at 37°C. The samples were analyzed by SDS-PAGE and fluorography.
Mutagenesis of the Zeolin Coding Sequence
To change the six Cys codons of zeolin to Ser codons, the following pairs of primers were used (underlined letters indicate the mutated codons): forward 1, 5'-GGTGGATCCGGTGGGGGAGGGAGTGGTGGAGGCGGTTCTGGCGGTAGCGGATCTCAGCCACCTCCACCGGTCCATTTGCCCCCTCCAGTTCATTTACCGC-3'; reverse 1, 5'-GGTGCACAGGTGGAGGTAGGTGGACTGGAGGTGGAAGGTGAACAGGTGGGGGCAGATGAACGGGAGGCGGTAAATGAACTGGAGGG-3'; forward 2, 5'-CCACCTACCTCCACCTGTGCACCTCCCACCTCCCGTTCATGTACCGCCACCTGTGCATTTACCACCTCCACCTAGCCACTATCCTACTCAGCCTCCA-3'; reverse 2, 5'-CTGCAGCTATTGCGACGGACTAGGATGAGGCTGTTGTGACGGAGACGGGTGTGGTTGAGGATGCGGTTGTGGTCTTGGAGGCTGAGTAGGATAGT-3'. After annealing and filling in, using the zeolin coding sequence inserted into the pDHA plasmid (pDHA-zeolin) (Mainieri et al., 2004
) as template, PCR amplification was performed using the primers 5'-GGTGGATCCGGTGGGGG-3' (forward) and 5'-TTCCAATGCATTGGCTGCAGCTATTGCGACGG-3' (reverse). The PCR product was restricted with BamHI and PstI and used to substitute for the corresponding fragment of wild-type zeolin in the HindIII/XbaI zeolin fragment cloned into pBluescript II SK. The mutated HindIII/XbaI fragment was finally excised and used to substitute for the corresponding sequence in pDHA-zeolin, to produce pDHA-zeolin(Cys).
Supplemental Data
The following materials are available in the online version of this article.
| Acknowledgments |
|---|
| Footnotes |
|---|
[W] Online version contains Web-only data. ![]()
www.plantcell.org/cgi/doi/10.1105/tpc.106.042226
Received March 2, 2006; Revision received July 21, 2006. accepted September 19, 2006.
| REFERENCES |
|---|
|
|
|---|
Anelli, T., Alessio, M., Bachi, A., Bergamelli, L., Bertoli, G., Camerini, S., Mezghrani, A., Ruffato, E., Simmen, T., and Sitia, R. (2003). Thiol-mediated protein retention in the endoplasmic reticulum: The role of ERp44. EMBO J. 22, 50155022.[CrossRef][Web of Science][Medline]
Arvan, P., Zhang, B.Y., Feng, L., Liu, M., and Kuliawat, R. (2002). Lumenal protein multimerization in the distal secretory pathway/secretory granules. Curr. Opin. Cell Biol. 14, 448453.[CrossRef][Web of Science][Medline]
Bagga, S., Adams, H., Kemp, J.D., and Sengupta-Gopalan, C. (1995). Accumulation of 15-kilodalton zein in novel protein bodies in transgenic tobacco. Plant Physiol. 107, 1323.[Abstract]
Bagga, S., Adams, H., Rodriquez, F.D., Kemp, J.D., and Sengupta-Gopalan, C. (1997). Co-expression of the maize
- and ß-zein genes results in stable accumulation of
-zein in ER-derived protein bodies formed by ß-zein. Plant Cell 9, 16831696.[Abstract]
Ben-Zeev, O., Mao, H.Z., and Doolittle, M.H. (2002). Maturation of lipoprotein lipase in the endoplasmic reticulum. Concurrent formation of functional dimers and inactive aggregates. J. Biol. Chem. 277, 1072710738.
Braakman, I., Helenius, J., and Helenius, A. (1992). Manipulating disulfide bond formation and protein folding in the endoplasmic reticulum. EMBO J. 11, 17171722.[Web of Science][Medline]
Chanat, E., Weiss, U., Huttner, W.B., and Tooze, S.A. (1993). Reduction of the disulfide bond of chromogranin B (secretogranin I) in the trans-Golgi network causes its missorting to the constitutive secretory pathways. EMBO J. 12, 21592168.[Web of Science][Medline]
Coleman, C.E., Herman, E.M., Takasaki, K., and Larkins, B.A. (1996). The maize
-zein sequesters
-zein and stabilizes its accumulation in protein bodies of transgenic tobacco endosperm. Plant Cell 8, 23352345.[Abstract]
Crofts, A.J., Leborgne-Castel, N., Pesca, M., Vitale, A., and Denecke, J. (1998). BiP and calreticulin form an abundant complex that is independent of endoplasmic reticulum stress. Plant Cell 10, 813824.[Medline]
Frigerio, L., de Virgilio, M., Prada, A., Faoro, F., and Vitale, A. (1998). Sorting of phaseolin to the vacuole is saturable and requires a short C-terminal peptide. Plant Cell 10, 10311042.
Frigerio, L., Vine, N.D., Pedrazzini, E., Hein, M.B., Wang, F., Ma, J.K., and Vitale, A. (2000). Assembly, secretion, and vacuolar delivery of a hybrid immunoglobulin in plants. Plant Physiol. 123, 14831494.
Geli, M.I., Torrent, M., and Ludevid, D. (1994). Two structural domains mediate two sequential events in
-zein targeting: Protein endoplasmic reticulum retention and protein body formation. Plant Cell 6, 19111922.
Gorr, S.U., Huang, X.F., Cowley, D.J., Kuliawat, R., and Arvan, P. (1999). Disruption of disulfide bonds exhibits differential effects on trafficking of regulated secretory proteins. Am. J. Physiol. 277, C121C131.[Web of Science][Medline]
Guenzi, S., Fra, A.M., Sparvoli, A., Bet, P., Rocco, M., and Sitia, R. (1994). The efficiency of cysteine-mediated intracellular retention determines the differential fate of secretory IgA and IgM in B and plasma cells. Eur. J. Immunol. 24, 24772482.[Web of Science][Medline]
Hanton, S.L., Bortolotti, L.E., Renna, L., Stefano, G., and Brandizzi, F. (2005). Crossing the divideTransport between the endoplasmic reticulum and Golgi apparatus in plants. Traffic 6, 267277.[CrossRef][Web of Science][Medline]
Huuskonen, J., Jauhiainen, M., Ehnholm, C., and Olkkonen, V.M. (1998). Biosynthesis and secretion of human plasma phospholipid transfer protein. J. Lipid Res. 39, 20212030.
Isidoro, C., Maggioni, C., Demoz, M., Pizzagalli, A., Fra, A.M., and Sitia, R. (1996). Exposed thiols confer localization in the endoplasmic reticulum by retention rather than retrieval. J. Biol. Chem. 271, 2613826142.
Jämsä, E., Simonen, M., and Makarow, M. (1994). Selective retention of secretory proteins in the yeast endoplasmic reticulum by treatment of cells with a reducing agent. Yeast 10, 355370.[CrossRef][Web of Science][Medline]
Jürgens, G. (2004). Membrane trafficking in plants. Annu. Rev. Cell Dev. Biol. 20, 481504.[CrossRef][Web of Science][Medline]
Kawagoe, Y., Suzuki, K., Tasaki, M., Yasuda, H., Akagi, K., Katoh, E., Nishizawa, N.K., Ogawa, M., and Takaiwa, F. (2005). The critical role of disulfide bond formation in protein sorting in the endosperm of rice. Plant Cell 17, 11411153.
Klein, E.M., Mascheroni, L., Pompa, A., Ragni, L., Weimar, T., Lilley, K.S., Dupree, P., and Vitale, A. (2006). Plant endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. Plant J., in press.
Kogan, M.J., Lopez, O., Cocera, M., Lopez-Iglesias, C., De La Maza, A., and Giralt, E. (2004). Exploring the interaction of the surfactant N-terminal domain of
-zein with soybean phosphatidylcholine liposomes. Biopolymers 73, 258268.[CrossRef][Web of Science][Medline]
Lee, M.C., Miller, E.A., Goldberg, J., Orci, L., and Schekman, R. (2004). Bi-directional protein transport between the ER and Golgi. Annu. Rev. Cell Dev. Biol. 20, 87123.[CrossRef][Web of Science][Medline]
Lending, C.R., and Larkins, B.A. (1989). Changes in the zein composition of protein bodies during maize endosperm development. Plant Cell 1, 10111023.
Li, X., Wu, Y., Zhang, D.Z., Gillikin, J.W., Boston, R.S., Franceschi, V.R., and Okita, T.W. (1993). Rice prolamine protein body biogenesis: A BiP-mediated process. Science 262, 10541056.
Lodish, H.F., and Kong, N. (1993). The secretory pathway is normal in dithiothreitol-treated cells, but disulfide-bonded proteins are reduced and reversibly retained in the endoplasmic reticulum. J. Biol. Chem. 268, 2059820605.
Ma, J.K.-C., Lehner, T., Stabila, P., Fux, C.I., and Hiatt, A. (1994). Assembly of monoclonal antibodies with IgG1 and IgA heavy chain domains in transgenic tobacco plants. Eur. J. Immunol. 24, 131138.[Web of Science][Medline]
Mainieri, D., Rossi, M., Archinti, M., Bellucci, M., De Marchis, F., Vavassori, S., Pompa, A., Arcioni, S., and Vitale, A. (2004). Zeolin. A new recombinant storage protein constructed using maize
-zein and bean phaseolin. Plant Physiol. 136, 34473456.
Nebenführ, A., Ritzenthaler, C., and Robinson, D.G. (2002). Brefeldin A: Deciphering an enigmatic inhibitor of secretion. Plant Physiol. 130, 11021108.
Pedrazzini, E., Giovinazzo, G., Bielli, A., de Virgilio, M., Frigerio, L., Pesca, M., Faoro, F., Bollini, R., Ceriotti, A., and Vitale, A. (1997). Protein quality control along the route to the plant vacuole. Plant Cell 9, 18691880.[Abstract]
Pedrazzini, E., Giovinazzo, G., Bollini, R., Ceriotti, A., and Vitale, A. (1994). Binding of BiP to an assembly-defective protein in plant cells. Plant J. 5, 103110.[CrossRef][Web of Science]
Piñeiro, M., Garcia-Olmedo, F., and Diaz, I. (1994). Redox modulation of the expression of bacterial genes encoding cysteine-rich proteins in plant protoplasts. Proc. Natl. Acad. Sci. USA 91, 38673871.
Reddy, P., Sparvoli, A., Fagioli, C., Fassina, G., and Sitia, R. (1996). Formation of reversible disulfide bonds with the protein matrix of the endoplasmic reticulum correlates with the retention of unassembled Ig light chains. EMBO J. 15, 20772085.[Web of Science][Medline]
Rutkowski, D.T., and Kaufman, R.J. (2004). A trip to the ER: Coping with stress. Trends Cell Biol. 14, 2028.[CrossRef][Web of Science][Medline]
Sawyer, J.T., Lukaczyk, T., and Yilla, M. (1994). Dithiothreitol treatment induces heterotypic aggregation of newly synthesized secretory proteins in HepG2 cells. J. Biol. Chem. 269, 2244022445.
Shewry, P.R., and Halford, N.G. (2002). Cereal seed storage proteins: Structures, properties and role in grain utilization. J. Exp. Bot. 53, 947958.
Shewry, P.R., Napier, J.A., and Tatham, A.S. (1995). Seed storage proteins: Structures and biosynthesis. Plant Cell 7, 945956.[CrossRef][Web of Science][Medline]
Sitia, R., and Braakman, I. (2003). Quality control in the endoplasmic reticulum protein factory. Nature 426, 891894.[CrossRef][Medline]
Sonnichsen, B., Fullekrug, J., Nguyen Van, P., Diekmann, W., Robinson, D.G., and Mieskes, G. (1994). Retention and retrieval: Both mechanisms cooperate to maintain calreticulin in the endoplasmic reticulum. J. Cell Sci. 107, 27052717.[Abstract]
Szczesna-Skorupa, E., and Kemper, B. (2000). Endoplasmic reticulum retention determinants in the transmembrane and linker domains of cytochrome P450 2C1. J. Biol. Chem. 275, 1940919415.
Tatu, U., Braakman, I., and Helenius, A. (1993). Membrane glycoprotein folding, oligomerization and intracellular transport: Effects of dithiothreitol in living cells. EMBO J. 12, 21512157.[Web of Science][Medline]
Trombetta, E.S., Simons, J.F., and Helenius, A. (1996). Endoplasmic reticulum glucosidase II is composed of a catalytic subunit, conserved from yeast to mammals, and a tightly bound noncatalytic HDEL-containing subunit. J. Biol. Chem. 271, 2750927516.
Valetti, C., and Sitia, R. (1994). The differential effects of dithiothreitol and 2-mercaptoethanol on the secretion of partially and completely assembled immunoglobulins suggest that thiol-mediated retention does not take place in or beyond the Golgi. Mol. Biol. Cell 5, 13111324.[Abstract]
Verde, C., Pascale, M.C., Martire, G., Lotti, L.V., Torrisi, M.R., Helenius, A., and Bonatti, S. (1995). Effect of ATP depletion and DTT on the transport of membrane proteins from the endoplasmic reticulum and the intermediate compartment to the Golgi complex. Eur. J. Cell Biol. 67, 267274.[Web of Science][Medline]
Vitale, A., and Ceriotti, A. (2004). Protein quality control mechanisms and protein storage in the endoplasmic reticulum. A conflict of interests? Plant Physiol. 136, 34203426.
Vitale, A., and Hinz, G. (2005). Sorting of proteins to storage vacuoles: How many mechanisms? Trends Plant Sci. 10, 316323.[CrossRef][Web of Science][Medline]
Vuori, K., Pihlajaniemi, T., Myllyla, R., and Kivirikko, K.I. (1992). Site-directed mutagenesis of human protein disulphide isomerase: Effect on the assembly, activity and endoplasmic reticulum retention of human prolyl 4-hydroxylase in Spodoptera frugiperda insect cells. EMBO J. 11, 42134217.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
A. Lombardi, A. Barbante, P. D. Cristina, D. Rosiello, C. L. Castellazzi, L. Sbano, S. Masci, and A. Ceriotti A Relaxed Specificity in Interchain Disulfide Bond Formation Characterizes the Assembly of a Low-Molecular-Weight Glutenin Subunit in the Endoplasmic Reticulum Plant Physiology, January 1, 2009; 149(1): 412 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Foresti, F. De Marchis, M. de Virgilio, E. M. Klein, S. Arcioni, M. Bellucci, and A. Vitale Protein Domains Involved in Assembly in the Endoplasmic Reticulum Promote Vacuolar Delivery when Fused to Secretory GFP, Indicating a Protein Quality Control Pathway for Degradation in the Plant Vacuole Mol Plant, November 1, 2008; 1(6): 1067 - 1076. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. de Virgilio, F. De Marchis, M. Bellucci, D. Mainieri, M. Rossi, E. Benvenuto, S. Arcioni, and A. Vitale The human immunodeficiency virus antigen Nef forms protein bodies in leaves of transgenic tobacco when fused to zeolin J. Exp. Bot., July 1, 2008; 59(10): 2815 - 2829. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | THE PLANT CELL | PLANT PHYSIOLOGY | |
|---|---|---|---|