Plant Cell Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

First published online April 14, 2006; 10.1105/tpc.105.036376

The Plant Cell 18:1253-1273 (2006)
© 2006 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/5/1253    most recent
tpc.105.036376v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maruyama, N.
Right arrow Articles by Utsumi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maruyama, N.
Right arrow Articles by Utsumi, S.
Agricola
Right arrow Articles by Maruyama, N.
Right arrow Articles by Utsumi, S.

Multiple Vacuolar Sorting Determinants Exist in Soybean 11S Globulin

Nobuyuki Maruyamaa, Leong Ching Muna, Miyuki Tatsuharaa, Machiko Sawadaa, Masao Ishimotob and Shigeru Utsumia,1

a Laboratory of Food Quality Design and Development, Graduate School of Agriculture, Kyoto University, Gokasho, Uji, Kyoto 611-0011, Japan
b National Agricultural Research Center for Hokkaido Region, Toyohira-ku, Sapporo, Hokkaido 062-8555, Japan

1 To whom correspondence should be addressed. E-mail sutsumi{at}kais.kyoto-u.ac.jp; fax 81-774-38-3761.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 REFERENCES
 
The sorting determinants of glycinin, a soybean (Glycine max) 11S globulin, which mediates protein targeting to the protein storage vacuole (PSV), were investigated in maturing soybean cotyledons by transient expression assays. A C-terminal stretch of 10 amino acids of A1aB1b, a glycinin group I subunit, was sufficient to direct green fluorescent protein (GFP) to the PSV. This peptide may correspond to a C-terminal vacuolar sorting determinant (ctVSD). Because functional inhibition of this putative ctVSD of A1aB1b did not block PSV sorting of A1aB1b, we used the three-dimensional structure of A1aB1b to identify candidates for a sequence-specific determinant (ssVSD). We found that the sequence downstream of disordered region 4 could direct GFP to the PSV and that Ile-297 is critical for sorting. However, functional inhibition of the ctVSD, combined with the Ile297Gly mutation, did not abolish the vacuolar sorting of A1aB1b, suggesting that A1aB1b has a third sorting determinant in addition to ctVSD and ssVSD. A glycinin group II subunit, A3B4, lacked a ctVSD but contained a VSD reminiscent of an ssVSD and an additional sorting determinant. We also demonstrate, by expression of dominant negative mutants of small GTPases and drug treatment experiments, that the trafficking of A1aB1b is COPII vesicle–dependent and wortmannin- and brefeldin A–sensitive.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 METHODS
 REFERENCES
 
Plant cells contain multiple vacuoles, some of which have storage or digestive functions. Leaf tissues mainly possess lytic vacuoles containing proteases that contribute to cellular protein turnover. Lytic vacuoles are present in immature pea (Pisum sativum) cotyledon cells, but during maturation they are replaced by protein storage vacuoles (PSVs) (Hoh et al., 1995Go). Vacuoles can be defined by the presence of specific tonoplast intrinsic proteins (TIPs): {alpha}-TIP is associated with the PSV, whereas {gamma}-TIP is found in lytic or degradative vacuoles (Paris et al., 1996Go). TIPs are also found in various combinations in a single vacuole (Jauh et al., 1998Go, 1999Go).

Secretory proteins destined to be transported to plant vacuoles must possess a vacuolar sorting determinant (VSD). VSDs are classified into three types: the sequence-specific VSD (ssVSD), the C-terminal VSD (ctVSD), and the physical structure VSD (psVSD) (Matsuoka and Neuhaus, 1999Go; Vitale and Raikhel, 1999Go). The ssVSDs contain a conserved NPIRL-like motif. The ctVSDs are present in the C-terminal regions of polypeptides and are often rich in hydrophobic amino acids. However, their lengths and sequences are highly variable. Little information has been obtained about the psVSDs. In the case of 11S globulin legumin from field bean (Phaseolus vulgaris), the psVSD is postulated to comprise surface patches on the molecular surface resulting from the folding of polypeptides (Saalbach et al., 1991Go).

The seed storage proteins of soybean (Glycine max) are composed mainly of glycinin, an 11S globulin, and ß-conglycinin, a 7S globulin. Glycinin accounts for ~40% of total seed protein and has a hexameric structure with a molecular mass of 300 to 380 kD (Utsumi, 1992Go). The five major subunits of glycinin have been identified and classified into two groups according to their amino acid sequences (group I: A1aB1b, A1bB2, and A2B1a; group II: A3B4 and A5A4B3). Each subunit is composed of an acidic polypeptide with a molecular mass of ~32 kD and a basic polypeptide with a molecular mass of ~20 kD. The acidic and basic polypeptides are linked by a disulfide bond. The sequence identity within each group is ~80%, and that between groups is ~45%.

In soybean cotyledon cells, the constituent subunits are synthesized as a single polypeptide precursor, preproglycinin. The signal sequence is removed cotranslationally in the endoplasmic reticulum (ER), and the resultant proglycinin assembles into trimers. Proglycinins are sorted to the PSV. After a specific posttranslational cleavage occurs between Asn and Gly residues, a mature hexameric structure is formed. We previously determined the three-dimensional structures of a proglycinin A1aB1b homotrimer and a mature glycinin A3B4 homohexamer (Adachi et al., 2001Go, 2003Go).

Recently, we revealed that the C-terminal 10 amino acids of the ß-conglycinin {alpha}' and ß subunits are essential for sorting to the PSV in stably transformed Arabidopsis thaliana seeds and in a transient expression assay using maturing soybean cotyledons (Nishizawa et al., 2003Go, 2004Go). These C-terminal regions are exposed on the molecular surface, as determined by three-dimensional structures of the ß subunit (Maruyama et al., 2001Go) and the core region of the {alpha}' subunit (Maruyama et al., 2004Go). Conversely, the VSDs of glycinin remain unclear. It is difficult to examine VSDs of glycinin in seed cells, because seeds in most plant species contain endogenous 11S globulin, which can form hybrid molecules with expressed derivatives. Recently, mutant soybean lines with storage protein compositions different from that of the wild type have been developed (Yagasaki et al., 1997Go; Takahashi et al., 2003Go). A glycinin-null line has also been developed. We can use this null line to examine the VSDs of glycinin in soybean seeds.

Here, we show that the C-terminal 10 amino acids of A1aB1b are sufficient for sorting to the PSV in a glycinin-null line and that this determinant likely functions as a ctVSD. We searched for additional candidates for VSDs based on the three-dimensional structure of A1aB1b and examined whether they could work as an ssVSD, because A1aB1b fused to green fluorescent protein (GFP) at its C terminus was partially sorted to PSVs. Among such candidates, the sequence downstream of disordered region 4 was able to direct a reporter protein to the PSV, and an Ile residue (Ile-297) in this sequence was critical for sorting to the PSV. However, the simultaneous inhibition of the function of both the ctVSD and the ssVSD could not completely abolish the vacuolar sorting of A1aB1b, suggesting that A1aB1b has an additional sorting determinant. A3B4, one of the group II subunits, lacked a ctVSD but contained additional unidentified VSDs as well as the ssVSD.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 METHODS
 REFERENCES
 
The C-Terminal 10 Amino Acids of A1aB1b Are Sufficient for Sorting a Reporter Protein to the PSV
The last 10 amino acids (PQESQKRAVA) at the C terminus of A1aB1b, a group I subunit, are located on the molecular surface (Adachi et al., 2001Go). The ctVSDs of plant vacuolar proteins are often rich in hydrophobic amino acids, and their lengths and sequences are highly variable (Matsuoka and Neuhaus, 1999Go). Therefore, we first analyzed whether the C-terminal 10 amino acids of A1aB1b are sufficient to direct a reporter protein to the PSV. Previously, we developed a transient expression assay system using particle bombardment of maturing soybean cotyledons. We used GFP modified by adding four contiguous Gly (GGGG) residues to its C terminus (mGFP) as a reporter in the characterization of the VSD of ß-conglycinin, another major soybean seed storage protein (Nishizawa et al., 2003Go, 2004Go). This C-terminal modification of GFP is essential, because the C-terminal region of GFP works weakly as a ctVSD (Nishizawa et al., 2003Go, 2004Go) and a stretch of contiguous Gly residues was reported to inhibit the function of barley (Hordeum vulgare) lectin ctVSD (Dombrowski et al., 1993Go). As a control, we constructed a gene for a fusion protein that consists of the A1aB1b signal peptide and mGFP, and we introduced this plasmid into maturing soybean cotyledon cells by particle bombardment. In the cells expressing mGFP, fluorescence was detected in the nucleoplasm and/or the cytosol (data not shown). This was surprising because, in general, proteins having no VSDs are secreted to intercellular space (ICS). When we expressed a fusion protein that consists of the ß-conglycinin signal peptide and mGFP, fluorescence was detected in the ICS (Nishizawa et al., 2003Go, 2004Go). Thus, we considered that the signal peptide of A1aB1b was not fully functional at the N terminus of mGFP and therefore mGFP might inefficiently penetrate into the ER. Previously, we determined the three-dimensional structure of A1aB1b and demonstrated that six disordered regions exist (Adachi et al., 2001Go). Among these regions (1, 2, 3, 3', 4, and 5), the first (disordered region 1) is positioned at the N terminus and consists of nine amino acids. We constructed a gene for a fusion protein that consists of the signal peptide and nine N-terminal amino acids (disordered region 1) of A1aB1b fused to mGFP (dis1+GFP; Figure 1A ). Both the tobacco (Nicotiana tabacum) chitinase and the barley lectin ctVSDs can direct the reporter proteins to the PSV (nonacidic vacuole) (Paris et al., 1996Go; Di Sansebastiano et al., 1998Go). GFP fused to the lectin ctVSD (GFP:lectin) and monomeric red fluorescent protein (mRFP) fused to the chitinase ctVSD (mRFP:chitinase) were colocalized in maturing soybean cotyledon cells (Figure 2A ). Therefore, dis1+GFP was coexpressed with mRFP:chitinase (a PSV marker) in maturing soybean cotyledon cells. In cells expressing both dis1+GFP and mRFP:chitinase, dis1+GFP was detected in a reticular structure reminiscent of the ER as well as the ICS (some cells exhibited fluorescence only in the ICS), whereas mRFP:chitinase was observed only in the PSV (Figure 2B). This finding indicates that disordered region 1 of A1aB1b does not have a VSD. When dis1+GFP was appended to the C-terminal 10 amino acids of A1aB1b (dis1+GFP-CT10), fluorescence was clearly detected in the PSV in all cells expressing dis1+GFP-CT10, and several small puncta were also detected in some cells expressing dis1+GFP-CT10 (Figures 1B and 2C). The patterns of dis1+GFP-CT10 and mRFP:chitinase completely overlapped, indicating that the C-terminal 10 amino acids of A1aB1b can direct mGFP to the PSV. Furthermore, we appended six Gly residues to the C terminus of dis1+GFP-CT10 (dis1+GFP-CT10+Gly; Figure 1C) and introduced this construct into maturing cotyledon cells, because the vacuolar sorting function of ctVSDs is blocked by the addition of contiguous Gly residues. Fluorescence was observed in the ICS but not in the PSV (Figure 2D), indicating that the C-terminal 10 amino acids of A1aB1b work as a ctVSD.


Figure 1
View larger version (29K):
[in this window]
[in a new window]
  		Figure 1. Schemes of the Constructs Used in This Study and the Localization of Each Reporter Protein after Transient Expression in Soybean Cotyledons.

When the reporter proteins were secreted to the ICS, we observed fluorescence in the reticular structure reminiscent of the ER in addition to the ICS.

 

Figure 2
View larger version (43K):
[in this window]
[in a new window]
  		Figure 2. Localization of Reporter Proteins Fused to the C-Terminal Region or the Whole Sequence of A1aB1b.

Confocal images of maturing soybean cotyledon cells expressing GFP:lectin and mRFP:chitinase (A), dis1+GFP and mRFP:chitinase (B), dis1+GFP-CT10 and mRFP:chitinase (C), dis1+GFP-CT10+Gly and mRFP:chitinase (D), and A1aB1bGFP and mRFP:chitinase (E). V, PSV. Bars = 10 µm.

 
A1aB1b Contains a Second Sorting Determinant in Addition to the ctVSD
We examined whether or not the C-terminal 10 amino acids were necessary for the sorting of A1aB1b to the PSV. If a truncated glycinin subunit lacking a VSD is expressed in seeds of normal soybean lines, it can assemble with endogenous glycinin subunits and is sorted to the PSV by the VSD of the endogenous glycinin subunits. Thus, it is impossible to analyze the sorting ability of truncated glycinin in seeds of normal soybean lines. Recently, mutant soybean lines lacking glycinin have been developed (Yagasaki et al., 1997Go; Takahashi et al., 2003Go). Previously, we analyzed the trafficking of storage proteins to the PSV in the seeds of this glycinin-null line by immunoelectron microscopy and showed that these cells have a normal transport system to the PSV (Mori et al., 2004Go). Thus, we examined the sorting of A1aB1b fused at its C terminus with mGFP (GFP modified by adding four contiguous Gly residues to its C terminus) in maturing cotyledon cells of the glycinin-null line (A1aB1bGFP; Figure 1U). We anticipated that the fusion of mGFP to the C terminus of A1aB1b would disrupt deposition in the PSV, because it is essential that ctVSDs are located at the C terminus (Matsuoka and Neuhaus, 1999Go; Vitale and Raikhel, 1999Go). In most cells in which fluorescence was detected, it was observed in both the PSV and the ICS. Approximately 30 to 50% of total fluorescence in a single cell exists in the ICS (Figure 2E). These results suggest that although the C-terminal 10 amino acids of A1aB1b are necessary for efficient sorting to the PSV, A1aB1b contains an additional sorting determinant other than the ctVSD, one that can contribute some vacuolar sorting function.

Multiple Sorting Determinants Exist in A1aB1b
Disordered region 5 is contained within the C-terminal 10 amino acids, which can work as a VSD. The other disordered regions are prime candidates for a second VSD that would act through interaction with a receptor, because they are located on the molecular surface and have flexible structures. The region of A3B4 corresponding to disordered region 3' of A1aB1b is not disordered (Adachi et al., 2003Go). Thus, we examined whether or not additional VSDs exist in disordered regions 2, 3, and 4. Castor bean (Ricinus communis) 2S albumin and ricin have ssVSDs located on prolinker regions (Brown et al., 2003Go). Characterization of the NPIRL-like motif contained within the ssVSD of sweet potato (Ipomoea batatas) sporamin in tobacco BY2 cells (Matsuoka and Nakamura, 1999Go) indicated that the Ile residue in this motif can be replaced only with the Leu residue, whereas other residues are comparatively exchangeable. Similarly, Leu in the prolinker region of castor bean 2S albumin is critical for its vacuolar sorting (Brown et al., 2003Go; Jolliffe et al., 2003Go). These reports indicate that an Ile or Leu residue located on the molecular surface may play an important role in vacuolar sorting. Therefore, we searched for Leu or Ile residues located on the molecular surface using the three-dimensional structure of A1aB1b (Figure 3 ). Twelve Leu or Ile residues on the molecular surface were found (indicated by boxed letters in Figure 3). However, one of these, Leu-371, which is flanked by residues Ala-370 and Ile-372, has a buried side chain and therefore is unlikely to interact with a receptor. Thus, we tested the potential role of the 11 remaining Leu and Ile residues positioned on the molecular surface as VSDs (Figures 1K to 1R). We also tested the ability of each of the disordered regions to function as a VSD (Figures 1D to 1J). We used mGFP fused to the A1aB1b signal peptide and disordered region 1 at the N terminus (dis1+GFP) as a reporter to analyze the sorting ability of additional regions. To exclude the possibility that these sequences might function as ctVSDs, we added six contiguous Gly residues to the C terminus of each construct. In most constructs, fluorescence was observed only in a reticular structure reminiscent of the ER and the ICS (Figure 1). However, in the case of dis1+GFP appended to disordered region 4 and two adjacent regions, KGGLSVIKP and ICTMRL, which correspond to the N- and C-terminal extensions, respectively, of disordered region 4 (dis1+GFP-ext dis4), we observed fluorescence in the PSV as well as the ICS and the intracellular reticular structure (Figure 4A ). Furthermore, we examined the sorting ability of the isolated SVIKP sequence (dis1+GFP-SVIKP), disordered region 4 (dis1+GFP-dis4), and disordered region 4 fused to the ICTMR peptide (dis1+GFP-dis4+ICTMR). Both dis1+GFP-SVIKP and dis1+GFP-dis4 were secreted to the ICS (Figures 4B and 4C), whereas the fluorescence of dis1+GFP-dis4-ICTMR was detected in the PSV as well as the ICS and the internal reticular structures (Figure 4D). Interestingly, the sorting ability of dis1+GFP-dis4-ICTMR was almost completely abolished by the replacement of Ile in the sequence ICTMR with Gly (dis1+GFP-dis4+GCTMR; Figures 1J and 4E). Thus, Ile in dis1+GFP-dis4-ICTMR is critical for directing mGFP to the PSV, and this sequence might work as a VSD reminiscent of an ssVSD.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
  		Figure 3. Residues of A1aB1b Positioned on the Molecular Surface Determined by the Program Joy.

Uppercase and lowercase letters in the sequence of A1aB1b indicate the residues buried inside the molecule and positioned on the molecular surface, respectively. Italicized numbers above double underlined sequences indicate six disordered regions. Letters and numbers above single underlined sequences show ß-sheets and helices, respectively. Lowercase letters underneath the sequence show the related constructs shown in Figure 1 (italicized letters indicate the regions examined by the transient assay). Boxed letters indicate Leu or Ile residues positioned on the molecular surface.

 

Figure 4
View larger version (51K):
[in this window]
[in a new window]
  		Figure 4. Localization of Reporter Proteins Fused to the Internal Peptides of A1aB1b or Mutated A1aB1b.

Confocal images of maturing soybean cotyledon cells expressing dis1+GFP-ext dis4 and mRFP:chitinase (A), dis1+GFP-SVIKP and mRFP:chitinase (B), dis1+GFP-dis4 and mRFP:chitinase (C), dis1+GFP-dis4+ICTMR and mRFP:chitinase (D), dis1+GFP-dis4+GCTMR and mRFP:chitinase (E), and A1aB1bGFP/I297G and mRFP:chitinase (F). V, PSV. Bars = 10 µm.

 
Next, we examined whether or not the mutation of this critical Ile residue downstream of disordered region 4 affected the sorting ability of A1aB1b fused at its C terminus with mGFP (A1aB1bGFP/I297G, Figure 1V). Fluorescence was observed in both the PSV and the ICS (Figure 4F), similar to the case with A1aB1bGFP (Figure 2E). Thus, the contribution of this putative ssVSD to the vacuolar sorting of A1aB1b is low, and yet another VSD in addition to the ctVSD and the ssVSD likely exists in A1aB1b.

Both Recombinant A1aB1b Fused to mGFP at Its C Terminus and Its Derivative Can Fold Correctly
Previously, we showed that truncated {alpha}' and {alpha} subunits ({alpha}' and {alpha} core regions) of ß-conglycinin (Maruyama et al., 1998Go) and the modified proglycinin A1aB1b (Katsube et al., 1994Go) can fold correctly when expressed in Escherichia coli and that such proteins can fold correctly in transgenic rice (Oryza sativa) (Katsube et al., 1999Go) and Arabidopsis (Nishizawa et al., 2003Go) seeds. Thus, we believe that E. coli expression systems can be used to judge whether or not truncated proteins are likely to fold correctly in soybean seed cells. If A1aB1bGFP and its derivative can fold correctly in the E. coli expression system, we can rule out potential sorting defects arising from the conformational defects that might be induced by fusion with mGFP. First, we expressed A1aB1bGFP and A1aB1bGFP/I297G in E. coli Origami(DE3). Both A1aB1bGFP and A1aB1bGFP/I297G were expressed in E. coli and were almost completely soluble (data not shown). To confirm correct folding, we then analyzed their self-assembly and fluorescence arising from GFP chromophores. Extracts produced by sonication were applied to a Sephacryl S-300 HR gel filtration column, and fractions were analyzed by immunoblotting using anti-glycinin serum (Figure 5A ). The peaks of recombinant A1aB1bGFP and A1aB1bGFP/I297G were detected in fractions 10 to 12 (the elution time of fraction 11 was ~112.5 min). Under the same conditions, purified mature glycinin (hexamer; ~320 kD) and proglycinin A1aB1b (trimer; 160 kD) were eluted at 102.5 and 122.0 min, respectively. If A1aB1bGFP and A1aB1bGFP/I297G self-assemble into trimers similarly to proglycinin A1aB1b, the molecular mass of each should be 242 kD. Thus, the elution times on the gel filtration column indicate that A1aB1bGFP and A1aB1bGFP/I297G self-assembled into trimers. Finally, we compared the fluorescence profiles of the GFP chromophores of A1aB1bGFP and A1aB1bGFP/I297G in fraction 11 with that of GFP (Figure 5B). The excitation and emission spectra of fraction 11 containing A1aB1bGFP or A1aB1bGFP/I297G were almost identical to those of GFP reported previously (Heim et al., 1994Go). Thus, GFP and A1aB1b in A1aB1bGFP and A1aB1bGFP/I297G folded properly, and the fusion proteins self-assembled into trimers similarly to proglycinin in E. coli. These results imply that A1aB1bGFP and A1aB1bGFP/I297G are likely to fold correctly in maturing soybean cotyledon cells in our transient assay. Therefore, we consider it credible that A1aB1bGFP/I297G was sorted to the PSV via a third determinant.


Figure 5
View larger version (21K):
[in this window]
[in a new window]
  		Figure 5. Conformation of A1aB1b Fused to GFP and Its Derivative.

(A) A1aB1bGFP and A1aB1bGFP/I297G expressed in E. coli were subjected to Sephacryl S-300 HR column chromatography. Beginning at 60 min, fractions were collected every 5 min and were analyzed by immunoblotting with anti-glycinin antibody.

(B) Excitation and emission spectra of fractions containing A1aB1bGFP (solid line) and A1aB1bGFP/I297G (dotted line) were measured by an F-3000 fluorescence spectrophotometer (Hitachi).

 
A3B4, a Group II Subunit, Also Has Multiple Sorting Determinants
Previously, we determined the three-dimensional structure of A3B4, a group II subunit, and demonstrated that the overall structure of A3B4 is very similar to that of A1aB1b (Adachi et al., 2003Go). However, the sequence corresponding to the ctVSD of A1aB1b (PQESQKARAVA) does not exist in A3B4, and only a C-terminal Pro residue is exposed on the molecular surface. Nonetheless, A3B4 is correctly sorted to the PSV in seeds of the soybean group I and A5A4B3 null lines (only A3B4 exists as a glycinin subunit) (Mori et al., 2004Go), suggesting that A3B4 has a VSD distinct from a ctVSD. First, to confirm this, we examined the sorting ability of A3B4 fused at its C terminus with mGFP (A3B4GFP, Figure 1W). Although the fluorescence of A1aB1bGFP was detected in the PSV and the ICS (Figure 2E), we observed fluorescence of A3B4GFP only in the PSV and not in the ICS (Figure 6A ). Next, we investigated whether or not the region of A3B4 that corresponds to disordered region 4 appended to the sequence ICTMR of A1aB1b contains a VSD (dis1+GFP-A3B4dis4+ICTMK, Figure 1S). Fluorescence was detected in the PSV as well as in an internal reticular structure reminiscent of the ER (Figure 6B). It seems that the rate for PSV sorting of dis1+GFP-A3B4dis4+ICTMK was slower than that of dis1+GFP-dis4-ICTMR (Figure 1I). This difference in rate might be attributable to the difference in the sequence. Furthermore, we confirmed that the replacement of the Ile residue (the 326th residue from the N terminus of A3B4) in dis1+GFP-A3B4dis4+ICTMK by Gly (dis1+GFP-A3B4dis4+GCTMK, Figure 1T) completely abolished sorting to the PSV (Figure 6C). Therefore, the sequence downstream of disordered region 4 of A3B4 contains a VSD reminiscent of an ssVSD. The replacement of the Ile residue in the sequence ICTMK of A3B4GFP by Gly (A3B4GFP/I326G, Figure 1X) did not affect the sorting of A3B4GFP to PSVs at all (Figure 6D), suggesting that another VSD exists, possibly similar to the third VSD of A1aB1b.


Figure 6
View larger version (60K):
[in this window]
[in a new window]
  		Figure 6. Localization of Reporter Proteins Fused to Internal, Whole, or Mutated Sequences of A3B4.

Confocal images of maturing soybean cotyledon cells expressing A3B4GFP and mRFP:chitinase (A), dis1+GFP-A3B4dis4-ICTMK and mRFP:chitinase (B), dis1+GFP-A3B4dis4-GCTMK and mRFP:chitinase (C), and A3B4GFP/I326G and mRFP:chitinase (D). V, PSV. Bars = 10 µm.

 
Vacuolar Sorting of A1aB1b Is Brefeldin A– and Wortmannin-Sensitive
Drugs such as brefeldin A (BFA) and wortmannin have been used to analyze trafficking mechanisms along the secretory pathway (Brown et al., 2003Go). First, we examined the effect of BFA, which induces an ER/Golgi apparatus hybrid organelle in tobacco BY2 cultured cells (Ritzenthaler et al., 2002Go), on the sorting of dis1+GFP-CT10 and A1aB1bGFP/I297G. Previously, Arabidopsis ß1,2-xylosyltransferase (Pagny et al., 2003Go) and rat sialyltransferase (Boevink et al., 1998Go) fused to fluorescent proteins were used as markers for the Golgi apparatus in tobacco BY2 cultured cells and/or leaf epidermal cells. Thus, to confirm the Golgi apparatus localization of these fusions in soybean cotyledons, we examined the localization of Arabidopsis ß1,2-xylosyltransferase fused to mRFP (Xyl:mRFP) and rat sialyltransferase fused to GFP (ST:GFP). As expected, both showed spindle-like structures, which likely correspond to the Golgi apparatus, and completely overlapped each other (Figure 7A ). Thus, we used Xyl:mRFP as a Golgi apparatus marker in further experiments. dis1+GFP-CT10 and Xyl:mRFP were located in PSVs and spindle-like structures, respectively, in maturing soybean cotyledon cells cultured in medium without BFA (Figure 7B). However, in the presence of BFA, Xyl:mRFP showed a reticular pattern consistent with the redistribution of Golgi protein to the ER upon treatment with BFA, as reported previously (Ritzenthaler et al., 2002Go) (Figure 7C). However, unlike Xyl:mRFP, dis1+GFP-CT10 accumulated in globular structures and colocalized with an ER marker, mRFP-HDEL (Figure 7E). In the absence of BFA, mRFP-HDEL showed a characteristic ER reticular pattern (Figure 7D). A1aB1bGFP/I297G exhibited patterns similar to those of dis1+GFP-CT10 (Figures 8A to 8D ). These results imply that BFA induces a redistribution of Golgi proteins to a reticular ER-like structure in maturing soybean cotyledon cells, as reported previously in tobacco BY2 cells (Ritzenthaler et al., 2002Go). Furthermore, BFA treatment causes some ER residents to condense into globular structures in which both PSV and secreted proteins were localized, perhaps corresponding to an exaggerated subdomain in the ER/Golgi apparatus hybrid organelle.


Figure 7
View larger version (41K):
[in this window]
[in a new window]
  		Figure 7. Effect of BFA on Sorting of dis1+GFP-CT10 to the PSV.

Confocal images of maturing soybean cotyledon cells expressing the cytosolic and transmembrane domains of Arabidopsis ß1,2-xylosyltransferase fused to mRFP (Xyl:mRFP) and the cytosolic and transmembrane domains of rat sialyltransferase fused to GFP (ST:GFP) (A), dis1+GFP-CT10 and Xyl:mRFP ([B] and [C]), and dis1+GFP-CT10 and mRFP fused to the ER retention signal (mRFP:HDEL) ([D] and [E]). Maturing soybean cotyledon cells with introduced expression plasmids were incubated on the medium without ([A], [B], and [D]; these panels are shown as B5) or with ([C] and [E]; these panels are shown as BFA) BFA (20 to 50 µg/mL). Bars = 10 µm.

 

Figure 8
View larger version (61K):
[in this window]
[in a new window]
  		Figure 8. Effect of BFA on Sorting of A1aB1b/I297G to the PSV.

Confocal images of maturing soybean cotyledon cells expressing A1aB1b/I297G and Xyl:mRFP ([A] and [B]) and A1aB1b/I297G and mRFP:HDEL ([C] and [D]). Maturing soybean cotyledon cells with introduced expression plasmids were incubated on the medium without ([A] and [C]; these panels are shown as B5) or with ([B] and [D]; these panels are shown as BFA) BFA (20 to 50 µg/mL). Bars = 10 µm.

 
Next, we examined the effect of wortmannin, a phosphatidylinositol 3-kinase and phosphatidylinositol 4-kinase inhibitor. Preliminary experiments demonstrated that dis1+GFP-CT10 accumulated in punctate structures of various sizes inside maturing cotyledon cells treated with wortmannin. It was reported previously that the pea vacuolar sorting receptor (VSR) colocalizes with the endogenous tobacco VSR when the heterologous reporter was expressed in tobacco suspension culture cells and that this organelle corresponds to the prevacuolar compartment (Jiang and Rogers, 1998Go; Tse et al., 2004Go). Thus, to examine the punctate structures containing dis1+GFP-CT10 formed by wortmannin treatment, we used mRFP fused to Arabidopsis VSR1 (mRFP:VSR) and Xyl:mRFP as a prevacuolar compartment marker and a Golgi apparatus marker, respectively. We confirmed that mRFP:VSR was detected in punctate structures and was not colocalized with Arabidopsis ß1,2-xylosyltransferase fused to yellow fluorescent protein (Xyl:YFP; a Golgi apparatus marker) in maturing soybean cotyledon cells in either the absence or the presence of wortmannin (Figures 9A and 9B ). When mRFP:VSR and dis1+GFP-CT10 were coexpressed in the presence of wortmannin, ~80% of puncta (Figure 9D, arrowheads) containing dis1+GFP-CT10 were colocalized with mRFP:VSR. On the other hand, when Xyl:mRFP and dis1+GFP-CT10 were coexpressed, only ~10% of the puncta (Figure 9E, arrowheads) containing dis1+GFP-CT10 were colocalized with Xyl:mRFP. A1aB1bGFP/I297G exhibited patterns similar to those of dis1+GFP-CT10 (Figures 10A to 10C ). Thus, we interpret these patterns as evidence that the sorting of dis1+GFP-CT10 and A1aB1bGFP/I297G to the PSV and the ICS was blocked at several steps between the Golgi apparatus and the PSV and that both of these proteins accumulate predominantly in a prevacuolar compartment in the presence of wortmannin.


Figure 9
View larger version (34K):
[in this window]
[in a new window]
  		Figure 9. Effect of Wortmannin on Sorting of dis1+GFP-CT10 to the PSV.

Confocal images of maturing soybean cotyledon cells expressing the cytosolic and transmembrane domains of ß1,2-xylosyltransferase fused to YFP (Xyl:YFP; fluorescence is shown in green) and the cytosolic and transmembrane domains of Arabidopsis VSR1 fused to mRFP (mRFP:VSR) ([A] and [B]), mRFP:VSR and dis1+GFP-CT10 ([C] and [D]), and Xyl:mRFP and dis1+GFP-CT10 (E). Maturing soybean cotyledon cells expressing various plasmids were incubated in the medium without ([A] and [C]; these panels are shown as B5) or with ([B], [D], and [E]; these panels are shown as Wor) wortmannin (10 µM). Bars = 10 µm.

 

Figure 10
View larger version (42K):
[in this window]
[in a new window]
  		Figure 10. Effect of Wortmannin on Sorting of A1aB1bGFP/I297G to the PSV.

Confocal images of maturing soybean cotyledon cells expressing mRFP:VSR and A1aB1bGFP/I297G ([A] and [B]) and Xyl:mRFP and A1aB1bGFP/I297G (C). Maturing soybean cotyledon cells expressing various plasmids were incubated in the medium without ([A]; this panel is shown as B5) or with ([B] and [C]; these panels are shown as Wor) wortmannin (10 µM). Bars = 10 µm.

 
Vacuolar Sorting of A1aB1b Requires the SAR1/ARF1 Pathway
Recently, dominant negative mutants of small GTPases such as SAR/ARF/RAB have been used to analyze membrane traffic in plant cells (Takeuchi et al., 2000Go, 2002Go; Pimpl et al., 2003Go). We confirmed that mRNAs of SAR1 and ARF1 are synthesized in maturing Arabidopsis seed cells by RT-PCR (data not shown). To examine the effects of Arabidopsis sar1 and arf1 dominant negative mutants (sar1[H74L] and arf1[Q71L]), plasmids encoding dominant negative mutants and dis1+GFP-CT10 or A1aB1bGFP/I297G were transiently coexpressed in maturing soybean cotyledon cells. We observed no effect of the coexpression of wild-type SAR1 or ARF1 on vacuolar sorting (Figures 11A, 11C , 12A, and 12C ). However, upon coexpression of sar1[H74L], dis1+GFP-CT10 and A1aB1bGFP/I297G displayed a punctal and reticular pattern in all cells, indicating that vacuolar sorting was clearly inhibited (Figures 11B and 12B). Furthermore, arf1[Q71L] exhibited similar effects (Figures 11D and 12D). These results indicate that our transient expression assay can be applied to analyze the effect of dominant negative mutants of small GTPases and that SAR1 and ARF1 are involved in the vacuolar sorting of A1aB1b to the PSV in soybean cotyledon cells.


Figure 11
View larger version (92K):
[in this window]
[in a new window]
  		Figure 11. Effect of Coexpression of the Dominant Negative Mutant of SAR1 or ARF1 on Sorting of dis1+GFP-CT10 to the PSV.

dis1+GFP-CT10 was coexpressed with SAR1 wild type (A), sar1 dominant negative mutant (sar1[H74L]) (B), ARF1 wild type (C), or arf1 dominant negative mutant (arf1[Q71L]) (D). V, PSV. Bars = 10 µm.

 

Figure 12
View larger version (99K):
[in this window]
[in a new window]
  		Figure 12. Effect of Coexpression of the Dominant Negative Mutant of SAR1 or ARF1 on Sorting of A1aB1bGFP/I297G to the PSV.

A1aB1bGFP/I297G was coexpressed with SAR1 wild type (A), sar1 dominant negative mutant (sar1[H74L]) (B), ARF1 wild type (C), and arf1 dominant negative mutant (arf1[Q71L]) (D). V, PSV. Bars = 10 µm.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
METHODS
 REFERENCES
 
Characteristics of Sorting Determinants of 11S Globulins
Both castor bean 2S albumin and ricin contain an ssVSD within their pro-regions (Brown et al., 2003Go). Phaseolin, a common bean 7S globulin, has a VSD within the C-terminal four amino acids, AFVY (Frigerio et al., 1998Go). Transgenic plant leaves and/or protoplasts were used to identify and characterize these VSDs. Recently, we analyzed stably transformed Arabidopsis seeds and maturing soybean cotyledon cells transiently expressing ß-conglycinin {alpha}' and ß subunits and showed that their VSDs are located within their C-terminal regions (Nishizawa et al., 2003Go, 2004Go). Here, we used a transient expression assay system using soybean glycinin-null lines and demonstrated that the C-terminal region of the soybean 11S globulin A1aB1b subunit can function as a ctVSD in maturing soybean cotyledon cells. We blocked the function of the ctVSD by fusing mGFP to the C terminus of A1aB1b, but 50 to 70% of the A1aB1b fused to mGFP (A1aB1bGFP) was still sorted to PSV (Figure 2E). We systematically examined potential surface-located residues that might function as ssVSDs. We found one critical Ile residue downstream of disordered region 4 that appears to function as an ssVSD. Next, we examined whether replacement of this critical Ile residue with Gly in A1aB1bGFP (A1aB1bGFP/I297G) affects PSV sorting and observed fluorescence in both the PSV and the ICS, similar to the case with A1aB1bGFP (Figure 4F). Thus, we concluded that the contribution of an ssVSD to the vacuolar sorting of A1aB1b is low and that A1aB1b likely possesses another VSD, such as a psVSD. Interestingly, the C-terminal region of A3B4 is nine amino acids shorter than those of the group I subunits and that of A5A4B3, another group II subunit. The fusion of mGFP to the C terminus of A3B4 and the mutation of the Ile residue downstream of disordered region 4 to Gly did not block the vacuolar sorting at all, implying that A3B4 also has an additional psVSD similar to that of A1aB1b.

VSRs belong to one gene family encoding a type I membrane-spanning protein (Kirsch et al., 1994Go; Ahmed et al., 1997Go; Miller et al., 1999Go; Cao et al., 2000Go). The pea VSR, BP80, was initially purified from plant clathrin-coated vesicles. BP80 can bind to an ssVSD at pH 6.0 to 7.0 and releases it at pH 4.0 in vitro (Kirsch et al., 1994Go, 1996Go; Cao et al., 2000Go). Shimada et al. (2003)Go reported that 12S globulin and 2S albumin accumulate in the ICS in addition to the PSV in seeds of an Arabidopsis VSR1 (BP80 homolog) knockout mutant. The expression of the lumenal domain of a pumpkin (Cucurbita maxima) BP80 homolog fused to an ER retention signal, HDEL, in transgenic Arabidopsis plants prevents lytic vacuolar sorting of molecules containing an ssVSD (Watanabe et al., 2004Go). These results suggest that the BP80 gene family is involved in targeting to both the lytic vacuoles and the PSVs. However, another receptor for the ctVSD might exist, because BP80 has much greater affinity for the ssVSD than for the ctVSD (Kd of 37 nM for the ssVSD and 100 µM for the ctVSD) (Kirsch et al., 1994Go). It was recently proposed that the Arabidopsis receptor homology region transmembrane domain ring H2 motif protein (RMR1) functions as a sorting receptor for phaseolin, a common bean 7S globulin, which contains a ctVSD that mediates trafficking to the vacuole in Arabidopsis leaf protoplast (Park et al., 2005Go). Therefore, RMR1 homologs can be considered candidates for the ctVSD receptor of glycinin. In this study, inhibition of the function of the ctVSD of A1aB1b caused the partial secretion of A1aB1b to the ICS (Figure 2E). The ctVSD may direct A1aB1b to the PSV through an interaction with RMR1 and/or a VSR1 homolog. Additional sorting seems to be conferred by a psVSD, because the contribution of the ssVSD appears to be low. Because the precursor polypeptides of pea legumin cannot be released from membranes efficiently even after washing with chaotropic salts (Hinz et al., 1997Go), an unidentified receptor for the psVSD may recognize a hydrophobic patch of the molecular surface on A1aB1b and A3B4. Further studies are necessary to elucidate the receptor for the psVSD.

Although dis1+GFP-CT10, mRFP:chitinase, and GFP:lectin were sorted to the PSV completely, dis1+GFP and dis1+GFP-CT10+Gly were detected in a reticular structure reminiscent of the ER in addition to the ICS (Figures 2A to 2D). These results suggest that the ER exit rate of the secreted protein is slower than that of proteins sorted to the PSV. Lytic vacuolar sorting of a protein containing an ssVSD is prevented, and instead the protein is retained in the ER when coexpressed with the lumenal domain of a pumpkin BP80 homolog fused to an ER retention signal, HDEL (Watanabe et al., 2004Go). Furthermore, the pumpkin BP80 homolog can bind the internal propeptide of pumpkin 2S albumin (the ligand peptide) in the presence of Ca2+ (1 mM) across a wide pH range (pH 4.0, 5.5, and 7.0) (Watanabe et al., 2002Go). The Ca2+ concentration in the ER of plants is assumed to be ~1 mM (Reddy and Reddy, 2004Go). Thus, interaction between the VSD of seed storage proteins and the receptor might occur in the ER, and this might affect the ER exit rate.

Sorting Mechanism of 11S Globulin to PSV
Recently, many researchers have investigated the sorting mechanism to the lytic vacuole in Arabidopsis protoplasts (Takeuchi et al., 2000Go, 2002Go; Phillipson et al., 2001Go; Tormakangas et al., 2001Go; Pimpl et al., 2003Go; DaSilva et al., 2005Go). On the other hand, little is known about the sorting mechanism to the PSV, because techniques for investigating PSV sorting mechanisms have been limited. In our study, we used a transient system in maturing soybean cotyledon cells lacking glycinin and showed that the PSV sorting of both dis1+GFP-CT10 with a ctVSD and A1aB1bGFP/I297G with a psVSD was blocked by the coexpression of Arabidopsis sar1/arf1 dominant negative mutants (Figure 13A ) or by treatment with either BFA (Figure 13B) or wortmannin (Figure 13C).


Figure 13
View larger version (42K):
[in this window]
[in a new window]
  		Figure 13. Model Describing the PSV Sorting of A1aB1b.

(A) Cargo proteins with a ctVSD (dis1+GFP-CT10) or a psVSD (A1aB1bGFP/I297G) are carried by COPII vesicles from the ER to the Golgi apparatus under normal physiological conditions.

(B) Cargo proteins with a ctVSD or a psVSD accumulate in globular structures in the ER/Golgi hybrid organelle in the presence of BFA.

(C) The trafficking of cargo proteins with a ctVSD or a psVSD is blocked at several steps between the Golgi apparatus and the PSV by wortmannin treatment. These proteins accumulate predominantly in a prevacuolar compartment after wortmannin treatment.

 
COPII vesicles are involved in the trafficking of both dis1+GFP-CT10 and A1aB1bGFP/I297G in maturing cotyledon cells (Figure 13A), because an Arabidopsis sar1 dominant negative mutant blocked both PSV sorting and secretion to the ICS completely (Figures 11B and 12B). The coexpression of the arf1 dominant negative mutant also inhibited PSV sorting (Figures 11D and 12D). This might imply that proteins that cycle between the ER and the Golgi apparatus (e.g., cargo receptors) would be rapidly depleted on ARF1 inactivation, and this would impair the vacuolar sorting of both dis1+GFP-CT10 and A1aB1bGFP/I297G, because ARF1 is involved in retrograde transport from the Golgi apparatus to the ER via COPI vesicles. ARF1 has also been proposed to influence clathrin-coated vesicle formation via the recruitment of adaptor complexes to the trans-Golgi network (Stamnes and Rothman, 1993Go). Furthermore, the cytosolic domains of VSR1 proteins possess Tyr-based sorting motifs that can interact with µA-adaptin, which is part of an AP-1 clathrin coat adaptor protein complex (Happel et al., 2004Go; Robinson et al., 2005Go). Thus, the coexpression of the arf1 dominant negative mutant likely also inhibits the formation of clathrin-coated vesicles and the intracellular trafficking of VSR1. On the other hand, it has been observed that clathrin-coated vesicles attach to dense vesicles, which carry seed storage proteins to the prevacuolar compartment destined for the PSV, at the surface of the trans-Golgi network, in pea cotyledon storage parenchymal cells (Hohl et al., 1996Go). Therefore, coexpression of the arf1 dominant negative mutant might additionally cause defects in dense vesicle formation.

Many seed storage proteins are targeted to the PSV via the Golgi apparatus (Lord, 1985Go; Sturm et al., 1988Go; Hohl et al., 1996Go; Hillmer et al., 2001Go). However, precursor-accumulating vesicles that bud from the ER and bypass the Golgi apparatus (ER-derived vesicles; diameter, 300 to 500 nm) have also been identified in maturing pumpkin and castor bean endosperms (Hara-Nishimura et al., 1998Go). A direct role for COPII components in the ER export of large transport carriers has been suggested by hereditary mutations that show that an isoform of SAR1 is required for the efficient transport of chylomicron particles in intestinal cells (Jones et al., 2003Go; Lee et al., 2004Go; Fromme and Schekman, 2005Go). Therefore, COPII components may also play a role in the formation of large ER-derived vesicles/protein bodies in maturing seed cells. We have demonstrated here that COPII components are involved in the PSV sorting of A1aB1bGFP/I297G (Figures 12B and 13A). Soybean seeds lacking 11S globulin such as those used in this study have few ER-derived vesicles/protein bodies during maturing stages, whereas these structures are observed at high frequency in maturing soybean cotyledons containing large amounts of the group I subunits (A1aB1b, A1bB2, and A2B1a) (Mori et al., 2004Go). These results suggest that a large number of group I subunits is necessary for the formation of ER-derived vesicles/protein bodies in maturing cotyledons, but the expression level of A1aB1bGFP/I297G was probably low. Therefore, we consider it unlikely that A1aB1bGFP/I297G was transported via large ER-derived vesicles/protein bodies, and we assume that most of the A1aB1bGFP/I297G was transported from the ER to the Golgi apparatus by normal COPII vesicles in our transient assay.

BFA induces an ER/Golgi apparatus hybrid organelle in maturing soybean cotyledon cells (Figures 7, 8, and 13B), as reported previously in tobacco BY2 cells (Ritzenthaler et al., 2002Go). The fluorescence of dis1+GFP-CT10 (Figure 7C) and A1aB1bGFP/I297G (Figure 8B) was detected in globular structures within cells in the presence of BFA. These structures do not correspond to the PSV, and they are larger than the prevacuolar compartment. These globular compartments also contain the ER resident marker GFP:HDEL, implying that soluble cargo proteins such as dis1+GFP-CT10 and A1aB1bGFP/I297G accumulate in an exaggerated subdomain in the ER/Golgi apparatus hybrid organelle in the presence of BFA (Figure 13B).

It has been reported that vacuolar reporter proteins with a ctVSD are secreted into the medium upon treatment with wortmannin in tobacco BY2 cells (Matsuoka et al., 1995Go). It was recently reported that wortmannin may block the retrograde pathway from the prevacuolar compartment to the trans-Golgi network, thereby causing the vacuolar reporter to be secreted to the medium in Arabidopsis protoplasts (DaSilva et al., 2005Go). In our study, wortmannin did not cause the secretion of dis1+GFP-CT10 or A1aB1bGFP/I297G into the ICS; instead, these proteins accumulated in punctate compartments (Figures 9 and 10). The sorting of dis1+GFP-CT10 and A1aB1bGFP/I297G to the PSV and the ICS was blocked at several steps between the Golgi apparatus and the PSV, and both of these proteins accumulated predominantly in a prevacuolar compartment (Figure 13C). Therefore, wortmannin might inhibit a different step in ctVSD- and psVSD-dependent trafficking to the PSV than it does in ssVSD-dependent trafficking to the central vacuole. In mammalian cells, some of the effectors for RAB GTPases have Fab1/YOTB/Vac1/EEA1 (FYVE) domains, which can bind phosphatidylinositol 3-phosphate (Burd and Emr, 1998Go). Because wortmannin inhibits the activity of phosphatidylinositol 3- and 4-kinases, we propose that RAB GTPases are involved in the trafficking of seed storage proteins from the Golgi apparatus to the PSVs in plant seed cells and that lipid modification is important in this process (Figure 13C).

Transient Expression Assay System in Maturing Cotyledon Cells
The VSDs of phaseolin, 2S albumin, and ricin were investigated in protoplasts and transgenic plant leaves. Such systems are very useful, because protoplasts can be used for transient expression, for pulse–chase experiments, and for analyses of the effects of drugs such as wortmannin and BFA. Although the ctVSD-dependent pathway exists in leaf protoplasts, the vacuoles of protoplasts have largely been defined as lytic or central vacuoles. Therefore, we developed a similar transient expression system using maturing seeds to characterize the VSD required for PSV deposition (Nishizawa et al., 2003Go, 2004Go). Our system was also useful for examining the effects of the coexpression of dominant negative mutants and the effects of various drugs on vacuolar protein sorting. Furthermore, this system can be applied to the analysis of trafficking mechanisms in thick tissues such as stems as well as in maturing seeds. Thus, this system is a useful approach for elucidating the differences in trafficking mechanisms between plant species and between types of tissues, in addition to characterizing VSDs in maturing seed cells.


   METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
REFERENCES
 
Plasmid Construction for Transient Expression Assays
Constructs used in this work are shown in Figure 1 (not to scale). All constructs contain the promoter of the ß-conglycinin {alpha}' subunit (–963 to –1). We first constructed the A1aB1b signal peptide fused to GFP. To construct it, we used the following primers, 5'-AAAACAAAGGGAAAAAACTAGCTTGGCCATAGTATATCTTAAATTCTTTAATACGGTG-3' (the italic and underlined letters correspond to half of the signal peptide of A1aB1b and the 3' terminal region of the {alpha}' subunit promoter, respectively) and 5'-CTGCTTTTCAGTGGCTGCTGCTTCGCTGTGAGCAAGGGCGAGGAGCTGTTCACC-3' (the italic and underlined letters correspond to half of the signal peptide of A1aB1b and the 5' terminal region of the GFP coding sequence, respectively). This DNA fragment was amplified by PCR using pBSspmGFP (Nishizawa et al., 2003Go) (the {alpha}' subunit promoter, GFP fused to four contiguous Gly residues at its C terminus, and the nopaline synthase [nos] terminator were inserted into pBluescript SK–) as a template. The amplified fragment was self-ligated to construct pBSA1aB1bspmGFP. Furthermore, to construct dis1+GFP, we used two primers, 5'-TTGCTGAGGCTGCTCTCTGGAACTGAAAGCGAAGCAGCAGCCACTGAAAAGCAGAAAACAAAGGGAAAA-3' (the italic and underlined letters indicate disordered region 1 and the signal peptide of A1aB1b, respectively) and 5'-GTGAGCAAGGGCGAGGAGCTGTTC-3' (corresponding to the 5' terminal region of GFP) for PCR using pBSA1aB1bspmGFP as a template. To construct dis1+GFP-CT10, we used two primers, 5'-TAGGCGGCCGCCCGGCTGCAGATCGTT-3' (the stop codon is indicated by boldface letters) and 5'-AGCCACAGCTCTCTTCTGAGACTCCTGAGGTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' (the italic and underlined letters indicate A1aB1b C-terminal 10 amino acids and the 3' terminal region of GFP, respectively). The amplified fragment was self-ligated.

Next, to construct dis1+GFP-CT10+Gly, dis1+GFP-dis2, dis1+GFP-ext dis3, dis1+GFP-SVIKP, dis1+GFP-NALKP, dis1+GFP-DNRIESE, dis1+GFP-TNSLENQLDQ, dis1+GFP-TLE, dis1+GFP-QTSSPDIYNPQ, dis1+GFP-TSLD, dis1+GFP-LNGR, and dis1+GFP-DTPMI, we used dis1+GFP-CT10 as a template and the primer 5'-GGAGGAGGAGGAGGAGGATAGGCGGCCGCCCGGCTGCAGATCGTT-3' (the underlined and boldface letters indicate the sequences for six contiguous Gly residues and the stop codon, respectively) with the specific primers 5'-AGCCACAGCTCTCTTCTGAGACTCCTGAGGTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-CT10+Gly, 5'-TTGTGGTCTGCTGCTTTGTCCTCTTTGTTGAGGTTGTTGAGGCTCTTCAAATCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-dis2, 5'-TTCGTTTTCTTCTTCTTGCTGATGCTTTCCTTTCTGGCTTTGATGACCTCCTTGCTCTTGCTGATATTTTAGAAACTCTTGCTCTTGGTTCCCTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-ext dis3, 5'-TGGTTTTATCACGCTTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-SVIKP, 5'-CGGTTTGAGGGCATTTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-NALKP, 5'-TTCTGACTCTATACGGTTATCTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-DNRIESE, 5'-CTGGTCGAGCTGGTTCTCCAAGCTGTTGGTTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-TNSLENQLDQ, 5'-TTCCAGGGTTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' dis1+GFP-TLE, 5'-TTGAGGGTTGTAGATGTCAGGTGATGAAGTCTGTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-QTSSPDIYNPQ, 5'-GTCAAGGCTGGTTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-TSLD, 5'-CCGTCCATTCAATCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-LNGR, and 5'-GATCATGGGTGTATCTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGT-3' for dis1+GFP-DTPMI (the underlined and italic letters indicate the 3' terminal region of GFP and the specific region, respectively). The amplified fragments were self-ligated.

To construct dis1+GFP-dis4, dis1+GFP-ext dis4, dis1+GFP-dis4+ICTMR, and dis1+GFP-A3B4dis4+ICTMK, we amplified a DNA fragment for the {alpha}' subunit promoter, the signal peptide and disordered region 1 of A1aB1b, the GFP coding region fused to four Gly residues, and the nos terminator using dis1+GFP as a template and the following primers: 5'-TCCTCCTCCTCCCTTGTACAGCTCGTCCAT-3' (the underlined and italic letters indicate the sequences for the four Gly residues and the C-terminal region of GFP, respectively) and 5'-GGAGGAGGAGGAGGAGGATAGGCGGCCGCCCGGCTGCAGATCGTT-3' (the boldface and underlined letters indicate the stop codon and the 5' terminal region of the nos terminator with the NotI site, respectively). To amplify disordered region 4 and its extended version, we used the following primers: 5'-CCCACGGACGAGCAGCAACAAAGAC-3' and 5'-GGTCTCGTCAATGCCATTTCTTCTT-3' for dis1+GFP-dis4, 5'-AGCGTGATAAAACCACCCACGGACGAGCAG-3' and 5'-AAGTCTCATGGTGCATATGGTCTCGTCAATGCC-3' for dis1+GFP-ext dis4, and 5'-CCCACGGACGAGCAGCAACAAAGACCCCAGGAAGAG-3' and 5'-TCTCATGGTGCATATGGTCTCGTCAATGCC-3' for dis1+GFP-dis4+ICTMR. To amplify disordered region 4 with ICTMK of A3B4, we used the following primers: 5'-AAGTGGCAAGAACAAGAAGACGAAGACGAA-3' and 5'-CTTCATGGTGCAAATATTTTCCTCAACCCC-3'. The fragment corresponding to disordered region 4 or its extended version was ligated to the DNA fragment for the {alpha}' subunit promoter, the signal peptide and disordered region 1 of A1aB1b, the GFP coding region, and the nos terminator. To construct dis1+GFP-dis4+GCTMR, we used dis1+GFP-dis4+ICTMR as a template and the following primers: 5'-ATTTCTTCTGCTTTTGCTTTGGCTTCCTCG-3' and 5'-GGCATTGACGAGACCGGATGCACCATGAGA-3' (the boldface letters indicate the mutation site). To construct dis1+GFP-A3B4dis4+GCTMK, the following primers were used: 5'-ATTTCTAGTCTGACATCCTCT-3' and 5'-GGGGTTGAGGAAAATATTGGCACCATGAAG-3' (the boldface letters indicate the mutation site). The amplified fragments were self-ligated.

To construct A1aB1bGFP and A3B4GFP, we first amplified the DNA fragments for the {alpha}' subunit promoter and the A1aB1b and A3B4 coding regions by PCR using the following pairs of primers: 5'-CGGGGATCCGTTTTCAAATTTGAATTTTAATGTGTGTTGTAAG-3' (the boldface letters indicate the BamHI site) and 5'-AGTATATCTTAAATTCTTTAATAC-3' for the {alpha}' subunit promoter, 5'-ATGGCCAAGCTTGTTTTTTCCCTTT-3' and 5'-AAGGAAAAAAGCGGCCGCCTAAGCCACAGCTCTCTTCTGAGACTCC-3' for the A1aB1b coding region (the boldface letters indicate the NotI site), and 5'-ATGGGGAAGCCCTTCTTCACTCTCTC-3' and 5'-AAGGAAAAAAGCGGCCGCTTATGGGTTGACCAAAGGGCCGGAGTTTC-3' for the A3B4 coding region (the boldface letters indicate the NotI site). The PCR products were digested by BamHI or NotI. The resultant DNA fragments (the {alpha}' promoter plus the A1aB1b coding region or the {alpha}' promoter plus the A3B4 coding region) were inserted into the BamHI and NotI sites of pUC18 containing the nos terminator. Next, we inserted GFP at the C terminus of the coding region of A1aB1b or A3B4. The following pairs of primers were used to amplify the {alpha}' promoter and the A1aB1b coding region inserted into pUC18 with the nos terminator: 5'-TAGGCGGCCGCCCGGCTGCAGATCGTTC-3' (the boldface letters indicate the stop codon) and 5'-AGCCACAGCTCTCTTCTGAGACTCC-3' corresponded to the C-terminal region of A1aB1b for A1aB1bGFP and 5'-TAGGCGGCCGCCCGGCTGCAGATCGTTC-3' (the boldface letters indicate the stop codon) and 5'-TGGGTTGACCAAAGGGCCGGAGTTTC-3' for A3B4GFP. The GFP coding region was amplified by PCR using the following primers: 5'-GTGAGCAAGGGCGAGGAGCTGTTCA-3' and 5'-CTTGTACAGCTCGTCCATGCCGT-3'. The PCR product for the GFP coding region was ligated to construct the plasmid for A1aB1bGFP or A3B4GFP. The direction of the inserted fragment was checked by PCR. To construct A1aB1bGFP/I297G, the fragment was amplified by the following primers: 5'-ATTTCTTCTGCTTTTGCTTTGGCTTCCTCG-3' and 5'-GGCATTGACGAGACCGGATGCACCATGAGA-3' (the boldface letters indicate the mutation site). To construct A3B4GFP/I326G, the fragment was amplified by the following primers: 5'-CTCAACCCCATTTCTAGTCTGACATCCTCTTCCACGTGG-3' and 5'-GAAAATATTGGCACCATGAAGCTTCACGAG-3' (the boldface letters indicate the mutation site). The sequences of the promoter and the coding regions were confirmed by ABI Prism 310 and ABI 3100 avant DNA analyzers (Applied Biosystems).

Plasmid Construction for Markers on the Transient Assay
We constructed the expression plasmids for GFP fused to the barley (Hordeum vulgare) lectin C-terminal propeptide (GFP:lectin), mRFP fused to the chitinase C-terminal propeptide (mRFP:chitinase), mRFP fused to the ER retention signal (mRFP:HDEL), mRFP fused to the Arabidopsis thaliana ß-1,2-xylosyltransferase transmembrane and cytosolic domains (Xyl:mRFP), GFP fused to rat sialyltransferase cytosolic and transmembrane domains (ST:GFP), and Arabidopsis VSR1 transmembrane and cytosolic domains fused to mRFP (mRFP:VSR). To generate the construct for GFP:lectin, we amplified the DNA fragment using two primers (5'-CAACTCCACTCTTGTCGCAGAATGAGCGGCCGCCCGGCTGCAGATCGTTCAAAC-3' and 5'-GCGGCGATGGCCTCGGCGAAGACTCCTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCCGTGAGTGAT-3'; the underlined letters correspond to the sequences for the lectin C-terminal propeptide). To construct the plasmid for ST:GFP, we sequentially amplified DNA fragments using four different primer combinations: (1) 5'-GAACTTTTTCTTCAAGTTGGTATGAATCATAGTATATCTTAAATTCTTTAATACGGTGTA-3' and 5'-CAGATGCCCAAGAGCCAGGAGAAAGTGGCCGTGAGCAAGGGCGAGGAGCTGTTCACCGGG-3'; (2) 5'-GAACAGGAGAAAGACCAGGATGAAGAGGCTGAACTTTTTCTTCAAGTTGGTATGAATCAT-3' and 5'-GAGGCCCTTACACTGCAAGCCAAGGAATTCCAGATGCCCAAGAGCCAGGAGAAAGTGGCC-3'; (3) 5'-CCAAACACAGATGACTGCGAACAGGAGAAAGACCAGGATGAAGAGGCT-3' and 5'-AAGAAAGGGAGCGACTATGAGGCCCTTACACTGCAAGCCAAGGAATTC-3'; and (4) 5'-CAAGCCAAGGAATTCCAGATGCCCAAGAGC-3' and 5'-CAGTGTAAGGGCCTCATAGTCGCTCCCTTTC-3'. The resultant amplified fragments were self-ligated. This plasmid contains the sequence for the N-terminal 52 amino acids of the rat sialyltransferase.

To generate the plasmids for mRFP:chitinase and mRFP:HDEL, we first constructed the plasmid containing the sequences corresponding to the promoter and signal peptide of ß-conglycinin {alpha}', the mRFP coding region, six Gly residues, and the nos terminator (pBSpro-sp-mRFP-nos). To generate the plasmid for mRFP:HDEL, we amplified the DNA fragment using the two primers 5'-GAGTTCGTCGTGCCTCCTCCTCCTCCTCCGGCGCCGGTGGAGTGGCGGCCCTCGGCGCG-3' and 5'-TAGGGCGGCCGCCCGGCTGCACGTTCAAAC-3' and pBSpro-sp-mRFP-nos as a template. On the other hand, to generate the plasmid for mRFP:chitinase, we used the two primers 5'-AAGAAGACCTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCC-3' and 5'-GTCGATACAATGTGAGCGGCCCGGCTGCAGATCGTTCAAAC-3'. The plasmids for mRFP:HDEL and mRFP:chitinase contain the sequences for the C-terminal propeptide (GLLVDTM) of tobacco (Nicotiana tabacum) chitinase and the ER retention signal (HDEL), respectively. To generate the plasmid for Xyl:mRFP, the annealed DNA fragment corresponding to the N-terminal 35 amino acids of Arabidopsis ß1,2-xylosyltransferase (5'-ATGAGTAAACGGAATCCGAAGATTCTGAAGATTTTTCTGTATATGTTACTTCTCAACTCTCTCTTTCTCATCTACTTCGTTTTTCACTCATCGTCGTTTTCA-3' and 5'-TGAAAACGACGATGAGTGAAAAAACGAAGTAGATGATGAGAAAGAGAGAGTTGAGAAGTAACATATACAGAAAAATCTTCAGAATCTTCGGATTCCGTTTACTCAT-3') was inserted between the promoter of ß-conglycinin {alpha}' promoter and mRFP in pBSpro-sp-mRFP-nos. To generate mRFP:VSR, we amplified the DNA fragment using the primers 5'-ACTTGCATAGGTTCAGGCAAAGTTGGAACC-3' and 5'-TTTTCCTTTTGCGGCCGCTCATATATCCATATGGTGACCACTTGTGTT-3' and the cDNA of Arabidopsis VSR1 (RIKEN Bioresource Center; identification code pda04573) as a template. Amplified fragment digested by NotI was inserted between the mRFP coding region and the nos terminator in pBSpro-sp-mRFP-nos. The resultant plasmid contains the sequence corresponding to the C-terminal 72 amino acids of VSR1.

Sequences of the promoter and coding regions were confirmed by ABI Prism 310 and ABI 3100 avant DNA analyzers (Applied Biosystems).

Plasmid Construction for Dominant Negative Mutants of Arabidopsis SAR1 and ARF1
The DNA for SAR1 and ARF1 subcloned by PCR from an Arabidopsis mRNA (Seki et al., 1998Go, 2002Go) was from the RIKEN Bioresource Center (identification codes pda06812 and pda07393). The coding regions of SAR1 and ARF1 were amplified by the following primers: 5'-ATGTTCTTGTTCGATTGGTTCTAC-3' and 5'-TTTTCCTTTTGCGCCCGCTTAGTTGATGTACTGAGAGAGCC-3' for SAR1 and 5'-ATGGGGTTGTCATTCGGAAAGTTG-3' and 5'-TTTTCCTTTTGCGGCCGCCTATGCCTTGCTTGCGATGTTGTTG-3' for ARF1 (the boldface letters indicate the NotI site). The plasmids containing the {alpha}' promoter and the nos terminator were amplified by the following primers: 5'-AGTATATCTTAAATTCTTTAATAC-3' and 5'-TTTTCCTTTTTAGGCGGCCGCCTGCAGATCGTTCAAACATTTGG-3', respectively (the boldface letters indicate the NotI site). To construct plasmids to express SAR1 and ARF1, the DNA fragments for SAR1 and ARF1 coding regions were digested by NotI and ligated with the plasmid containing the {alpha}' promoter and the nos terminator. To construct the dominant negative mutants of SAR1 and ARF1 (sar1[H74L] and arf1[Q71L]), mutations were introduced by the following primers: 5'-ATCTGAAGACCACCCAAATCAAAAG-3' and 5'-TGCTCGTAGGGTTTGGAAAGATTAC-3' for sar1[H74L] and 5'-ATCTTGTCTAGACCCCCAACATCCC-3' and 5'-CCGTCCATTGTGGAGACATTACTTC-3' for arf1[Q71L] (the boldface letters indicate the mutation sites). The amplified fragments were self-ligated. Sequences of the promoter and coding regions were confirmed by ABI Prism 310 and ABI 3100 avant DNA analyzers (Applied Biosystems).

Transient Expression Assay in Soybean Seed Cells
Maturing soybean (Glycine max) cotyledons were taken out of their pods and immersed in 70% (v/v) ethanol to sterilize their surfaces. After rinsing with sterile water, they were cut into halves and placed on Murashige and Skoog agar plates. Particle bombardment was performed with Biolistic PDS-1000/He (Bio-Rad) according to the instructions of the manufacturer. Five hundred micrograms of gold microcarriers (particle size of 1.0 µm) coated with 2 to 3 µg of plasmids was used for each bombardment. To examine the dominant negative effects of SAR1 and ARF1, ~1 µg of dis1+GFP-CT10 or A1aB1bGFP/I297G was mixed with ~2 µg of the plasmids for the dominant negative mutants, and then gold microcarriers were coated with them. Each sample was bombarded twice under the following conditions: vacuum, 26 to 28 inches of Hg; target distance, 9 cm; and helium pressure, 1100 p.s.i. After the bombardment, cotyledons were placed on the B5 agar plates and incubated at 25°C in the dark for 24 to 35 h. In the experiments for the drugs, wortmannin or BFA dissolved in DMSO was added to B5 medium. In control experiments, we added the same amount of DMSO as that of BFA or wortmannin to B5 medium.

Confocal Laser Scanning Microscopy
Thin sections (<1 mm) cut with razor blades from the surfaces of the soybean cotyledons that had been bombarded and incubated were placed on glass slides and covered with cover glasses. Fluorescent images were obtained using an MRC-1024 confocal laser scanning microscope (Bio-Rad). GFP was excited at a laser wavelength of 488 nm and detected through a filter for a laser wavelength of 506 to 538 nm. We checked >25 cells for each construct, and typical patterns are shown in Figures 2, 4, 6, and 7 to 12GoGoGoGoGo.

Plasmid Construction for Expression in Escherichia coli
DNA fragments for the coding regions of A1aB1bGFP and A1aB1bGFP/I297G were amplified by the following primers: 5'-TTCAGTTCCAGAGAGCAGCCTCAGC-3' and 5'-TTTTCCTTTTGCGGCCGCTCAAGCCACAGCTCTCTTCTGAGACTCC-3' (the boldface letters indicate the NotI site). The PCR products were blunted and then digested with NotI. The resultant DNA fragments were inserted into the NcoI (filled-in) and NotI sites of pET-21d vector to construct the expression plasmids pEA1aB1bGFP and pEA1aB1bGFP/I297G.

Expression of Recombinant A1aB1b Fused to GFP and Its Derivatives
pEA1aB1bGFP and pEA1aB1bGFP/I297G were transformed into E. coli Origami(DE3) (Novagen). Cells harboring individual expression plasmids were grown to A600 = 0.6 at 37°C in Luria-Bertani medium before induction of expression with 1 mM isopropyl-1-thio-ß-D-galactopyranoside. After addition of isopropyl-1-thio-ß-D-galactopyranoside, culture was continued for 30 to 36 h at 20°C. Cells were harvested by centrifugation at 10,000g for 20 min at 4°C and stored at –80°C. Aliquots of the cells were analyzed by SDS-PAGE using 11% (w/v) acrylamide as described previously (Maruyama et al., 1998Go). Translational products were identified by immunoblotting. Frozen cells were resuspended in buffer A [35 mM sodium phosphate, pH 7.6, 0.4 M NaCl, 10 mM 2-mercaptoethanol, 1 mM EDTA, 0.1 mM (p-amidinophenyl)methanesulfonyl fluoride, and 0.02% NaN3] and disrupted by sonication on ice. Insoluble materials were separated from the soluble fractions by centrifugation at 10,000g for 20 min. The supernatant was used for a self-assembly experiment.

Self-Assembly
To analyze self-assembly, extracts from E. coli expressing A1aB1bGFP or A1aB1bGFP/I297G were subjected to Sephacryl S-300 HR gel filtration chromatography (Amersham Bioscience) at a flow rate of 0.5 mL/min using buffer A as an eluent. Fractions were collected every 5 min (2.5 mL) between 60 and 160 min. Each fraction was subjected to SDS-PAGE and immunoblotting with anti-glycinin serum.

Fluorescence Spectrometry
Fluorescence intensities arising from A1aB1bGFP and A1aB1bGFP/I297G were measured in a Hitachi F-3000 fluorescence spectrophotometer. The emission spectra were recorded from 300 to 700 nm at an excitation wavelength of 489 nm. The excitation spectra were recorded from 300 to 700 nm at an emission wavelength of 511 nm.

Accession Numbers
Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AY072220 (SAR1), AY074859 (ARF1), AY048289 (VSR1), and AF272852 (xylosyltransferase).


   Acknowledgments
 
We thank Elizabeth A. Miller (Columbia University) for critical reading of the manuscript. We also thank Y. Niwa (University of Shizuoka) for providing the GFP (S65T) gene and R.Y. Tsien (Howard Hughes Medical Institute, University of California, San Diego) for his gift of a plasmid (mRFP1 in pRSET). This work was supported in part by grants to N.M. from the Ministry of Education, Culture, Sports, Science, and Technology and the Fuji Foundation for Protein Research.


   Footnotes
 
The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantcell.org) is: Shigeru Utsumi (sutsumi{at}kais.kyoto-u.ac.jp).

Article, publication date, and citation information can be found at www.plantcell.org/cgi/doi/10.1105/tpc.105.036376.

Received July 21, 2005; Revision received January 17, 2006. accepted March 22, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 REFERENCES
 
Adachi, M., Kanamori, J., Masuda, T., Yagasaki, K., Kitamura, K., Mikami, B., and Utsumi, S. (2003). Crystal structure of soybean 11S globulin: Glycinin A3B4 homohexamer. Proc. Natl. Acad. Sci. USA 100, 7395–7400.[Abstract/Free Full Text]

Adachi, M., Takenaka, Y., Gidamis, A.B., Mikami, B., and Utsumi, S. (2001). Crystal structure of soybean proglycinin A1aB1b homotrimer. J. Mol. Biol. 305, 291–305.[CrossRef][Web of Science][Medline]

Ahmed, S.U., Bar-Peled, M., and Raikhel, N.V. (1997). Cloning and subcellular location of an Arabidopsis receptor-like protein that shares common features with protein-sorting receptors of eukaryotic cells. Plant Physiol. 114, 325–336.[Abstract]

Boevink, P., Oparka, K., Santa Cruz, S., Martin, B., Betteridge, A., and Hawes, C. (1998). Stacks on tracks: The plant Golgi apparatus traffics on an actin/ER network. Plant J. 15, 441–447.[CrossRef][Web of Science][Medline]

Brown, J.C., Jolliffe, N.A., Frigerio, L., and Roberts, L.M. (2003). Sequence-specific, Golgi-dependent vacuolar targeting of castor bean 2S albumin. Plant J. 36, 711–719.[CrossRef][Web of Science][Medline]

Burd, C.G., and Emr, S.D. (1998). Phosphatidylinositol(3)-phosphate signaling mediated by specific binding to RING FYVE domains. Mol. Cell 2, 157–162.[CrossRef][Web of Science][Medline]

Cao, X., Rogers, S.W., Butler, J., Beevers, L., and Rogers, J.C. (2000). Structure requirements for ligand binding by a probable plant vacuolar sorting receptor. Plant Cell 12, 493–506.[Abstract/Free Full Text]

DaSilva, L.L., Taylor, J.P., Hadlington, J.L., Hanton, S.L., Snowden, C.J., Fox, S.J., Foresti, O., Brandizzi, F., and Denecke, J. (2005). Receptor salvage from the prevacuolar compartment is essential for efficient vacuolar protein targeting. Plant Cell 17, 132–148.[Abstract/Free Full Text]

Di Sansebastiano, G.P., Paris, N., Marc-Martin, S., and Neuhaus, J.M. (1998). Specific accumulation of GFP in a non-acidic vacuolar compartment via a C-terminal propeptide-mediated sorting pathway. Plant J. 15, 449–457.[CrossRef][Web of Science][Medline]

Dombrowski, J.E., Schroeder, M.R., Bednarek, S.Y., and Raikhel, N.V. (1993). Determination of the functional elements within the vacuolar targeting signal of barley lectin. Plant Cell 5, 587–596.[Abstract]

Frigerio, L., de Virgilio, M., Prada, A., Faoro, F., and Vitale, A. (1998). Sorting of phaseolin to the vacuole is saturable and requires a short C-terminal peptide. Plant Cell 10, 1031–1042.[Abstract/Free Full Text]

Fromme, J.C., and Schekman, R. (2005). COPII-coated vesicles: Flexible enough for large cargo? Curr. Opin. Cell Biol. 17, 1–8.[CrossRef][Web of Science]

Happel, N., Höning, S., Neuhaus, J.-M., Pais, N., Robinson, D.G., and Holstein, S.E.H. (2004). Arabidopsis µA-adaptin interacts in vitro with the tyrosine motif of the vacuolar sorting receptor VSR-PS1. Plant J. 37, 678–693.[CrossRef][Web of Science][Medline]

Hara-Nishimura, I., Shimada, T., Hatano, K., Takeuchi, Y., and Nishimura, M. (1998). Transport of storage proteins to protein storage vacuoles is mediated by large precursor-accumulating vesicles. Plant Cell 10, 825–836.[Abstract/Free Full Text]

Heim, R., Prasher, D.C., and Tsien, R.Y. (1994). Wavelength mutations and posttranslational autoxidation of green fluorescent protein. Proc. Natl. Acad. Sci. USA 91, 12501–12504.[Abstract/Free Full Text]

Hillmer, S., Movafeghi, A., Robinson, D.G., and Hinz, G. (2001). Vacuolar storage proteins are sorted in the cis-cisternae of the pea cotyledon Golgi apparatus. J. Cell Biol. 152, 41–50.[Abstract/Free Full Text]

Hinz, G., Menze, A., Hohl, I., and Vaux, D. (1997). Isolation of prolegumin from developing pea seeds: Its binding to endomembranes and assembly into prolegumin hexamers in the protein storage vacuole. J. Exp. Bot. 48, 139–149.[Abstract/Free Full Text]

Hoh, B., Hinz, G., Jeong, B.-K., and Robinson, D.G. (1995). Protein storage vacuoles form de novo during pea cotyledon development. J. Cell Sci. 108, 299–310.[Abstract]

Hohl, I., Robinson, D.G., Chrispeels, M.J., and Hinz, G. (1996). Transport of storage proteins to the vacuole is mediated by vesicles without a clathrin coat. J. Cell Sci. 109, 2539–2550.[Abstract]

Jauh, G.Y., Fischer, A.M., Grimes, H.D., Ryan, C.A., Jr., and Rogers, J.C. (1998). {delta}-Tonoplast intrinsic protein defines unique plant vacuole functions. Proc. Natl. Acad. Sci. USA 95, 12995–12999.[Abstract/Free Full Text]

Jauh, G.Y., Phillips, T.E., and Rogers, J.C. (1999). Tonoplast intrinsic protein isoforms as markers for vacuolar functions. Plant Cell 11, 1867–1882.[Abstract/Free Full Text]

Jiang, L., and Rogers, J.C. (1998). Integral membrane protein sorting to vacuoles in plant cells: Evidence for two pathways. J. Cell Biol. 143, 1183–1199.[Abstract/Free Full Text]

Jolliffe, N.A., Ceriotti, A., Frigerio, L., and Roberts, L.M. (2003). The position of the proricin vacuolar targeting signal is functionally important. Plant Mol. Biol. 51, 631–641.[CrossRef][Web of Science][Medline]

Jones, B., et al. (2003). Mutations in a Sar1 GTPase of COPII vesicles are associated with lipid absorption disorders. Nat. Genet. 34, 29–31.[CrossRef][Web of Science][Medline]

Katsube, T., Gidamis, A.B., Kanamori, J., Kang, I.J., Utsumi, S., and Kito, M. (1994). Modification tolerability of the hypervariable region of soybean proglycinin. J. Agric. Food Chem. 42, 2639–2645.

Katsube, T., Kurisaka, N., Ogawa, M., Maruyama, N., Ohtsuka, R., Utsumi, S., and Takaiwa, F. (1999). Accumulation of soybean glycinin and its assembly with the glutelins in rice. Plant Physiol. 120, 1063–1074.[Abstract/Free Full Text]

Kirsch, T., Paris, N., Butler, J.M., Beevers, L., and Rogers, J.C. (1994). Purification and initial characterization of a potential plant vacuolar targeting receptor. Proc. Natl. Acad. Sci. USA 91, 3403–3407.[Abstract/Free Full Text]

Kirsch, T., Saalbach, G., Raikhel, N.V., and Beevers, L. (1996). Interaction of a potential vacuolar targeting receptor with amino- and carboxyl-terminal targeting determinants. Plant Physiol. 111, 469–474.[Abstract]

Lee, M.C., Miller, E.A., Goldberg, J., Orci, L., and Schekman, R. (2004). Bi-directional protein transport between the ER and Golgi. Annu. Rev. Cell Dev. Biol. 20, 87–123.[CrossRef][Web of Science][Medline]

Lord, J.M. (1985). Synthesis and intracellular transport of lectin and storage protein precursors in endosperm from castor bean. Eur. J. Biochem. 146, 403–409.[Web of Science][Medline]

Maruyama, N., Adachi, M., Takahashi, K., Yagasaki, K., Kohno, M., Takenaka, Y., Okuda, E., Nakagawa, S., Mikami, B., and Utsumi, S. (2001). Crystal structures of recombinant and native soybean ß-conglycinin ß homotrimers. Eur. J. Biochem. 268, 3595–3604.[Web of Science][Medline]

Maruyama, N., Katsube, T., Wada, Y., Oh, M.H., Barba de la Rosa, A.P., Okuda, E., Nakagawa, S., and Utsumi, S. (1998). The roles of the N-linked glycans and extension regions of soybean ß-conglycinin in folding, assembly and structural features. Eur. J. Biochem. 258, 854–862.[Web of Science][Medline]

Maruyama, Y., Maruyama, N., Mikami, B., and Utsumi, S. (2004). Structure of the core region of the soybean beta-conglycinin {alpha}' subunit. Acta. Crystallogr. D Biol. Crystallogr. D60, 289–297.[Medline]

Matsuoka, K., Bassham, D.C., Raikhel, N.V., and Nakamura, K. (1995). Different sensitivity to wortmannin of two vacuolar sorting signals indicates the presence of distinct sorting machineries in tobacco cells. J. Cell Biol. 130, 1307–1318.[Abstract/Free Full Text]

Matsuoka, K., and Neuhaus, J.M. (1999). Cis-elements of protein transport to the plant vacuoles. J. Exp. Bot. 50, 165–174.[Abstract/Free Full Text]

Matsuoka, K., and Nakamura, K. (1999). Large alkyl side-chains of isoleucine and leucine in the NPIRL region constitute the core of the vacuolar sorting determinant of sporamin precursor. Plant Mol. Biol. 41, 825–835.[CrossRef][Web of Science][Medline]

Miller, E.A., Lee, M.C., and Anderson, M.A. (1999). Identification and characterization of a prevacuolar compartment in stigmas of Nicotiana alata. Plant Cell 11, 1499–1508.[Abstract/Free Full Text]

Mori, T., Maruyama, N., Nishizawa, K., Higasa, T., Yagasaki, K., Ishimoto, M., and Utsumi, S. (2004). The composition of newly synthesized proteins in the endoplasmic reticulum determines the transport pathways of soybean seed storage proteins. Plant J. 40, 238–249.[CrossRef][Web of Science][Medline]

Nishizawa, K., Maruyama, N., Satoh, R., Fuchikami, Y., Higasa, T., and Utsumi, S. (2003). A C-terminal sequence of soybean ß-conglycinin {alpha}' subunit acts as a vacuolar sorting determinant in seed cells. Plant J. 34, 647–659.[CrossRef][Web of Science][Medline]

Nishizawa, K., Maruyama, N., Satoh, R., Higasa, T., and Utsumi, S. (2004). A vacuolar sorting determinant of soybean ß-conglycinin ß subunit resides in a C-terminal sequence. Plant Sci. 167, 937–947.

Pagny, S., Bouissonnie, F., Sarkar, M., Follet-Gueye, M.L., Driouich, A., Schachter, H., Faye, L., and Gomord, V. (2003). Structural requirements for Arabidopsis ß1,2-xylosyltransferase activity and targeting to the Golgi. Plant J. 33, 189–203.[CrossRef][Web of Science][Medline]

Paris, N., Stanley, C.M., Jones, R.L., and Rogers, J.C. (1996). Plant cells contain two functionally distinct vacuolar compartments. Cell 85, 563–572.[CrossRef][Web of Science][Medline]

Park, M., Lee, D., Lee, G.J., and Hwang, I. (2005). AtRMR1 functions as a cargo receptor for protein trafficking to the protein storage vacuole. J. Cell Biol. 170, 757–767.[Abstract/Free Full Text]

Phillipson, B.A., Pimpl, P., daSilva, L.L., Crofts, A.J., Taylor, J.P., Movafeghi, A., Robinson, D.G., and Denecke, J. (2001). Secretory bulk flow of soluble proteins is efficient and COPII dependent. Plant Cell 13, 2005–2020.[Abstract/Free Full Text]

Pimpl, P., Hanton, S.L., Taylor, J.P., Pinto-daSilva, L.L., and Denecke, J. (2003). The GTPase Arf1p controls the sequence-specific vacuolar sorting route to the lytic vacuole. Plant Cell 15, 1242–1256.[Abstract/Free Full Text]

Reddy, V.S., and Reddy, A.S. (2004). Proteomics of calcium-signaling components in plants. Phytochemistry 65, 1745–1776.[CrossRef][Web of Science][Medline]

Ritzenthaler, C., Nebenfuhr, A., Movafeghi, A., Stussi-Garaud, C., Behnia, L., Pimpl, P., Staehelin, L.A., and Robinson, D.G. (2002). Reevaluation of the effects of brefeldin A on plant cells using tobacco Bright Yellow 2 cells expressing Golgi-targeted green fluorescent protein and COPI antisera. Plant Cell 14, 237–261.[Abstract/Free Full Text]

Robinson, D.G., Oliviusson, P., and Hinz, G. (2005). Protein sorting to the storage vacuoles of plants: A critical appraisal. Traffic 6, 615–625.[CrossRef][Web of Science][Medline]

Saalbach, G., Jung, R., Kunze, G., Saalbach, I., Adler, K., and Muntz, K. (1991). Different legumin protein domains act as vacuolar targeting signals. Plant Cell 3, 695–708.[Abstract/Free Full Text]

Seki, M., Carninci, P., Nishiyama, Y., Hayashizaki, Y., and Shinozaki, K. (1998). High-efficiency cloning of Arabidopsis full-length cDNA by biotinylated CAP trapper. Plant J. 15, 707–720.[CrossRef][Web of Science][Medline]

Seki, M., et al. (2002). Functional annotation of a full-length Arabidopsis cDNA collection. Science 296, 141–145.[Abstract/Free Full Text]

Shimada, T., Fuji, K., Tamura, K., Kondo, M., Nishimura, M., and Hara-Nishimura, I. (2003). Vacuolar sorting receptor for seed storage protein in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 100, 16095–16100.[Abstract/Free Full Text]

Stamnes, M.A., and Rothman, J.E. (1993). The binding of AP-1 clathrin adaptor particles to Golgi membranes requires ADP-ribosylation factor, a small GTP-binding protein. Cell 73, 999–1005.[CrossRef][Web of Science][Medline]

Sturm, A., Voelker, T.A., Herman, E.M., and Chrispeels, M.J. (1988). Correct glycosylation, Golgi-processing, and targeting to protein bodies of the vacuolar protein phytohemagglutinin in transgenic tobacco. Planta 175, 170–183.[CrossRef]

Takahashi, M., Uematsu, Y., Kashiwaba, K., Yagasaki, K., Hajika, M., Matsunaga, R., Komatsu, K., and Ishimoto, M. (2003). Accumulation of high levels of free amino acids in soybean seeds through integration of mutations conferring seed protein deficiency. Planta 217, 577–586.[CrossRef][Web of Science][Medline]

Takeuchi, M., Ueda, T., Sato, K., Abe, H., Nagata, T., and Nakano, A. (2000). A dominant negative mutant of Sar1 GTPase inhibits protein transport from the endoplasmic reticulum to the Golgi apparatus in tobacco and Arabidopsis cultured cells. Plant J. 23, 517–525.[CrossRef][Web of Science][Medline]

Takeuchi, M., Ueda, T., Yahara, N., and Nakano, A. (2002). Arf1 GTPase plays roles in the protein traffic between the endoplasmic reticulum and the Golgi apparatus in tobacco and Arabidopsis cultured cells. Plant J. 31, 499–515.[CrossRef][Web of Science][Medline]

Tormakangas, K., Hadlington, J.L., Pimpl, P., Hillmer, S., Brandizzi, F., Teeri, T.H., and Denecke, J. (2001). A vacuolar sorting domain may also influence the way in which proteins leave the endoplasmic reticulum. Plant Cell 13, 2021–2032.[Abstract/Free Full Text]

Tse, Y.C., Mo, B., Hillmer, S., Zhao, M., Lo, S.W., Robinson, D.G., and Jiang, L. (2004). Identification of multivesicular bodies as prevacuolar compartments in Nicotiana tabacum BY-2 cells. Plant Cell 16, 672–693.[Abstract/Free Full Text]

Utsumi, S. (1992). Plant food protein engineering. Adv. Food Nutr. Res. 36, 89–208.[Medline]

Vitale, A., and Raikhel, N.V. (1999). What do proteins need to reach different vacuoles? Trends Plant Sci. 4, 149–155.[CrossRef][Web of Science][Medline]

Watanabe, E., Shimada, T., Kuroyanagi, M., Nishimura, M., and Hara-Nishimura, I. (2002). Calcium-mediated association of a putative vacuolar sorting receptor PV72 with a propeptide of 2S albumin. J. Biol. Chem. 277, 8708–8715.[Abstract/Free Full Text]

Watanabe, E., Shimada, T., Tamura, K., Matsushima, R., Koumoto, Y., Nishimura, M., and Hara-Nishimura, I. (2004). An ER-localized form of PV72, a seed-specific vacuolar sorting receptor, interferes the transport of an NPIR-containing proteinase in Arabidopsis leaves. Plant Cell Physiol. 45, 9–17.[Abstract/Free Full Text]

Yagasaki, K., Takagi, T., Sasaki, M., and Kitamura, K. (1997). Biochemical characterization of soybean protein consisting of different subunits of glycinin. J. Agric. Food Chem. 45, 656–660.




This article has been cited by other articles:


Home page
 Plant Physiol.Home page
I. Hwang
Sorting and Anterograde Trafficking at the Golgi Apparatus
Plant Physiology, October 1, 2008; 148(2): 673 - 683.
[Full Text] [PDF]

Home page
 Plant Cell PhysiolHome page
F. Takaiwa, C. Sakuta, S.-K. Choi, Y. Tada, T. Motoyama, and S. Utsumi
Co-Expression of Soybean Glycinins A1aB1b and A3B4 Enhances Their Accumulation Levels in Transgenic Rice Seed
Plant Cell Physiol., October 1, 2008; 49(10): 1589 - 1599.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
P. R. Hunter, C. P. Craddock, S. Di Benedetto, L. M. Roberts, and L. Frigerio
Fluorescent Reporter Proteins for the Tonoplast and the Vacuolar Lumen Identify a Single Vacuolar Compartment in Arabidopsis Cells
Plant Physiology, December 1, 2007; 145(4): 1371 - 1382.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. Sanmartin, A. Ordonez, E. J. Sohn, S. Robert, J. J. Sanchez-Serrano, M. A. Surpin, N. V. Raikhel, and E. Rojo
Divergent functions of VTI12 and VTI11 in trafficking to storage and lytic vacuoles in Arabidopsis
PNAS, February 27, 2007; 104(9): 3645 - 3650.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/5/1253    most recent
tpc.105.036376v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maruyama, N.
Right arrow Articles by Utsumi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maruyama, N.
Right arrow Articles by Utsumi, S.
Agricola
Right arrow Articles by Maruyama, N.
Right arrow Articles by Utsumi, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications THE PLANT CELL PLANT PHYSIOLOGY
Copyright © 2006 by the American Society of Plant Biologists