Supplemental Data

Files in this Data Supplement:

• Supplemental Figure 1 - Supplemental Figure 1. Kinetics of expression of gas1 during the biotrophic phase of U. maydis by real-time PCR. Six-day old maize seedlings were infected with a mixture of the compatible U. maydis wild type strains FB1 and FB2. At the time points indicated the third leaves of the infected maize plants were collected and used for total RNA isolation. Real time RT-PCR was used to assay the expression levels of gas1 using the constitutively expressed peptidylprolylisomerase gene ppi1 as control. First strand cDNAs were synthesized from 5 μg of total RNA using the ThermoScript RT-PCR System (Invitrogen life technologies) following the manufacturer's instructions. Quantitative real-time PCRs were performed using the Roche LightCycler and SYBR Green PCR Master Mix (Roche Biochemicals) and primers ffgasq (AAACCGCGTCGACCCTTT) and revgasq (ATGGCGCCGTACTTTTGG) for detection of gas1 and ffppiq (CGAGAACGAGGGCACCAA) and revppiq (GCGAAAAAGCGTTTAAAGAACAC) for detection of ppi1. Gene-specific primers were designed using Primer Express software (Applied Biosystems) to amplify a 70 bp product representing the 3’ end of the corresponding cDNA. The PCR conditions consisted of denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s and extension at 70°C for 30 s. Expression levels are presented as values relative to that of gas1 during growth in culture, after normalization to ppi1 levels. Six independent amplifications were performed, and the average of the results retained. The error bar indicates the standard deviation.