Article Figures & Data
Figures
- Figure 1.
Side Chain Modifications of Methionine-Derived Glucosinolates in Arabidopsis.
Potential side chain modifications for the elongated methionine derivative C4 dihomomethionine are shown. Steps with natural variation in Arabidopsis are shown in boldface to the right or left of each enzymatic arrow with the name of the corresponding locus.
- Figure 2.
HPLC Results of Ler, Cvi, and Col Glucosinolate Profiles.
Shown are HPLC results monitored at 229 nm of samples from Ler, Cvi, and Col prepared from equal amounts of 2-week-old rosette tissue. The major methionine-derived glucosinolate peaks are labeled for each ecotype. The large peak at ∼18.5 min in Ler and Col is a tryptophan-derived glucosinolate. The large peak at ∼2.5 min is due to solvent mixing from the injected sample. mAu, milliabsorbance units.
- Figure 3.
Fine-Scale Map of GS-AOP.
A fine-scale genomic map of GS-AOP is shown for reference. Horizontal solid lines represent the four BACs used, and the vertical lines represent the positions of the microsatellites on each BAC. The number to the right of each recombinant inbred population name is the number of recombinations between the given marker and the GS-AOP phenotype. The vertical black bar represents the genomic location of the three 2-ODD genes. The three 2-ODD genes and one related 2-ODD pseudogene are labeled AOP1, AOP2, AOP3, and Pseu, respectively. The F9H3 and T5J8 microsatellite markers are separated by ∼300 kb. The dotted line indicates the region between the two microsatellite markers for the Ler × Cvi cross (top line) or the Ler × Col cross (bottom line).
- Figure 4.
Ecotype-Specific Expression of the AOP Genes.
Shown are the ethidium bromide–stained gels from a quantitative RT-PCR experiment with the Ler, Col, and Cvi parental ecotypes. The Ran gene was used as a loading control. Numbers above the gels (1, 0.3, and 0.1) indicate the amounts of cDNA (μL) used for the RT-PCRs.
- Figure 5.
Enzymatic Activity of Heterologously Expressed AOP2.
HPLC results (monitored at 229 nm) of purified desulfoglucosinolates from bacterial extracts containing heterologously expressed AOP2 fusion proteins are shown. All compound identities were confirmed by comparison of both retention times and UV light absorption profiles with those of authentic standards. 3-MSO, 3-methylsulfinylalkyl glucosinolate; 4-MSO, 4-methylsulfinylalkyl glucosinolate.
(A) Extract from 3-methylsulfinylalkyl glucosinolate treated with uninduced AOP2 bacterial extract.
(B) Extract from 3-methylsulfinylalkyl glucosinolate treated with AOP2 enzyme.
(C) Extract from 4-methylsulfinylalkyl glucosinolate treated with uninduced AOP2 bacterial extract.
(D) Extract from 4-methylsulfinylalkyl glucosinolate treated with AOP2 enzyme.
- Figure 6.
Enzymatic Activity of AOP3 Heterologously Expressed in Escherichia coli.
E. coli extract was assayed with 3-methylsulfinylpropyl glucosinolate, and products were extracted and analyzed by HPLC as described in Methods.
(A) Sample of authentic 3-hydroxypropyl glucosinolate (monitored at 229 nm).
(B) Extract from AOP3 enzyme assay with 3-methylsulfinylpropyl glucosinolate as substrate (monitored at 229 nm).
(C) Diode array spectrum of standard 3-hydroxypropyl desulfoglucosinolate in (A).
(D) Diode array spectrum of 3-hydroxypropyl desulfoglucosinolate produced by AOP3 in (B).
- Figure 7.
Tree of AOP cDNAs from Ler, Cvi, and Col.
Cladogram of the relations of AOP1, AOP2, and AOP3 from the Ler, Cvi, and Col reference ecotypes. Either experimental cDNA sequences or predicted cDNA sequences from genomic sequences were used for the alignments shown. The scale was reduced between 0.02 and 0.16, and midpoint branching was used for this tree. Each sequence is listed with the ecotype from which it was obtained. AOP1 A. lyrata was obtained from A. lyrata.
- Figure 8.
Putative Enzymatic Reactions for the 2-ODD Genes in the GS-AOP Region.
The molecular structures and putative enzymatic reactions catalyzed by the AOP2 and AOP3 enzymes are shown. Side chains of up to eight carbon atoms (n = 6) are known in Arabidopsis. Heterologous expression studies demonstrated the conversion of methylsulfinylalkyl glucosinolates to their alkenyl and hydroxyalkyl derivatives for three-carbon-atom side chains (propyl; n = 1). For glucosinolates with four-carbon-atom side chains (butyl; n = 2), only the methylsulfinylalkyl-to-alkenyl conversion was demonstrated.
Tables
AOP2 Ecotype GS-AOP Expb Fxnlc AOP3 Exp AOP1.1 Exp AOP1.2 Exp Cal-0 ALK + + – + – Cnt-1 ALK + + – + – Kondara ALK + + – + – Cvi ALK + + – + – Ema-1 ALK + + – + – Hodja ALK + + – + – Kas-1 ALK + + – + – Mrk-0 ALK + + – + – Sorbo ALK + + – + – Su-0 ALK + + – + – Tac ALK + + – + – Yo-0 ALK + + – + – Per-1 Null + – – + – Col Null + – – + – Bl-1 OHP – + – + Ka-0 OHP – + – + Ler OHP – + – + Lip-0 OHP – + – + Pet OHP – + – + Pi-0 OHP – + – + Wei-0 OHP – + – + Name Repeat Sequence Ler Col Cvi F9H3-F TA TTGCCAAAATTTCTGTAGCA 126 130 122 F9H3-R CTCGACGACTTGTTGTTGGT T5J8-F1 GAA GCCAAGACGCAGAAGAAGAG 125 150 225 T5J8-R1 TCTCATTATTCCCCACAATGC F4C21-F TA GCGCTTCATCTAGTTACGCTTT 165 171 167 F4C21-R CCCGGACTGAACCAAACTAA T5J8-F2 TA CGATCATCGGTGTTCACCTT 160 125 140 T5J8-R2 GAAAATAAATCGTCATATGGTGTACTG AOP1-F ATGGATTCAGACTTTGTTCCT AOP1-R AAAGGCAGCGAAAGCATGG AOP2-F ATGGGTTCATGCAGTCTTCA AOP2-R TGCTTCGGAGACGGCACAAT AOP3-F ATGGGTTCATGCAGTCCTC AOP3-R TTTCCCAGCAGAGACGCC
