Table 1.

Intron/Exon Splice Site Junctions in the Pea COP1 Gene

IntronaNucleotide Positionb5′ Donor3′ Acceptorc
1307–648AAG GTTGGCTTCG ACATTTGTAG CTA
2727–2938AAG GTAGGTGATACTTGAAACAG GGC
33094–3374AAG GTGTGCTTGATCATCTGTAG GTG
43732–4745CAG GTTATCTTAGCTTGGTCCAG TTC
54905–5010CAG GTACTACTATATTGAAACAG CCG
65076–6946AAG GTGAGTTATT TGTATTGCAG CAT
77026–7785GCG GTAAGATGGATGCTTTTCAG GTC
87943–8057AAG GTAATTGTGACCTTTGGCAG AGT
98166–8482AAG GTATTCTATACTTTGAGCAG GTC
108587–8884GCA GTATGTTCCTATTTTTACAG GTT
119074–9220CCA GTACGTAATCATGTGTACAG GTT
129331–9411AAG GTTTGTGATCTCCTTTGCAG GAA
7′AAACCTCACC ATGd
ConsensusCorGAG GTAAGTTTTTTTGCAG G
  • a Introns were identified by comparing the sequence of the COP1 cDNA identified using RT-PCR with COP1 genomic DNA.

  • b Nucleotide position shown is relative to start codon.

  • c Splice sites underlined were not identified as boundary elements by etPlantGene intron prediction software.

  • d Sequence of 3′ boundary of intron 7′ from the COP1 gene in lip1 peas.