Table 2.

Primers Described In This Study

GeneMutant AlleleaPrimer NameSequence
SYP21ForwardCATCATCTTCGTCTTCGTTTGTTCCC
Nested forwardGAGAGATTCGAGAGAAGAGACGAG
ReverseCAATTTGGTTGAATGGGGAAGATGGAGT
Nested reverseGTTTCCATAGATTCGCTTGATGCTTGAAG
Primer 1bGACAAGGTTACAGATATCCGAATTGGTG
Primer 2bACCTGAACTGGATACTGAATCTTTAAG
Primer 3bTAGAAGAAGAGCTTGCTGCTGGGAGAT
Primer 4bSame as reverse from above
syp21-1cT-DNA left (primer Tb)CGCACTCAAGTCTTTCATCTACGGCAATGACC
T-DNA left nestedAGATAGCTGGGCAATGGAATCCGAGGAGG
syp21-2dSpm 5′GGTGCAGCAAAACCCACACTTTTACTTC
dSpm 5′ nestedCCGACACTCTTTAATTAACTGACATC
dSpm 3′CTTATTTCAGTAAGAGTGTGGGGTTTTGG
dSpm 3′ nestedGACACTCCTTACCTTTTTTCTTGTA
SYP22ForwardGAGATTAGAGAAAACTCCGATAACCAA
Forward nestedATCAATACCGGAGTCTCCACGTTTCAG
ReverseACAACAAAAAGCCACACACGCACACA
Reverse nestedCAATAGAACCTCAAACCGAACTGAACCA
syp22dT-DNA leftCTCATCTAAGCCCCCATTTGGACGTGAATG
T-DNA left nestedTTGCTTTCGCCTATAAATACGACGGATCG
T-DNA rightTGGGAAAACCTGGCGTTACCCAACTTAAT
SYP41ForwardCGATTGTGTTCAGATCGGAGCTG
Forward nestedGCGACGAGGAATCGTACGTTGCTG
ReverseGACATCGACCTCTGACTATCTAT
Reverse nestedGAGATGACAAGCACGGATGCGCAC
syp41dSpm primers are same as listed above for syp21-2
SYP42ForwardCGTCTTTGCGCCACCGTGTTAAAACGTGTG
Forward nestedCACACACTTATATTGACCCTATCGCGCAAG
ReverseTCATGTGTTATTGAATTTGGAGGACTAGTG
Reverse nestedATACTTCTACAGATTTGGTAAAACGATTG
syp42T-DNA primers are same as listed for syp22
  • a Primers specific to the DNA inserted in these alleles (i.e., for the particular T-DNA or transposon).

  • b Primers described in Figures 2 and 3.

  • c syp21-1 T-DNA locus is inserted with two left borders (see text), so no right border primers are listed.

  • d syp22 was identified using only left border primers, and the listed right border primer was used only to verify the opposite end of the insertion.