Table 2.

Primers Used in This Study

Primer NameSequence
SYP111GCTCTAGACTCGAGTCAATTCTTCCCACACAGAAT
SYP112GCTCTAGACTCGAGTCAATTCTTCCCACTCAGAATGTT
SYP124CCGCTCGAGTCTAGATTACATCAACAAGCTGCGACGCTC
SYP125CCGCTCGAGTCTAGATTACATCAACAAGCTGCGACGCTC
SYP127CCGCTCGAGTCTAGATCAATGCCGAGTCACTATCCT
SYP128GGAGCGAGCTCCATATGGCTTCGAGTGCTTCAAAATTC
SYP129CATATGGAGCTCGCAGATGCAAACGAAGTAGTG
SYP130CATATGGAGCTCGCTTCAAGTGCTTCAAAGTTC
SYP135CCGCTCGAGTCTAGATCAATGCCGAGTCACTATCCTCCCACTCAGAACATT
SYP136ACGGCAGTTTATCAAATGTTC
SYP137TAAACTGCCGTGATTCGACTT
SYP142CATATGGAGCTCAGTGCTTCGAAGTTCATAAAA
SYP143CCGCTCGAGTCTAGATTAAGCAGCGGTGCAACCTCC
SYP144CCGCTCGAGTCTAGATTAAGCAGCGGTGCTACCTCCACA
SYP145GCGGAAGTCTCTCAAACATTCT
SYP146AGAGACTTCCGCTGCGAGG
SYP147GCTCTAGACTCGAGTTACTTCCCACACAGAATGTTTGA
SYP149GGCTCTAGATCAATGCCGAGTCACATTCTTCCCACACAGAATGTT
SYP150GCAGATCTAGATTAAGCAGCGGTGCTACCTCCACTGACAATACTC
SYP151GCAGATCTAGATCAAGCGGTGCAACCTCCACAGAC
SYP155TGTTACTGTTGGAGATGTGGCTGTTGGGAAGACATG
SYP156CATGTCTTCCCAACAGCCACATCTCCAACAGTAACA
SYP160ATAGAAGATCCGGTAGCTCCATTGCGAGTATTG
SYP161CAATACTCGCAATGGAGCTACCGGATCTTCTATG