Table 3.

Motif Recognition in 5′ Regions

−45GC (ARE)
 −146GT (ARE)
 −155Footprint
 −195Gbox-1
 −216ARE
 −360
ADH1 motifCAATTACCGCCCCTAGGCAAAACCGCCAAGCCACGTGGACCCGAAACC
Cluster consensusCmCTTnCCGCCCATTGGCAAAACCGCCAAGnCACGTGGCCCCGAmACn
  • Shown are motifs found in cluster 2 that are similar to regulatory elements identified in the ADH1 promoter. Motifs are ordered according to their positions in the ADH1 promoter. The ADH1 motif sequences are displayed, as is the consensus sequence for each motif.