Table 2.

Most Highly Conserved Simple Dispersed Repeats Present in the C. reinhardtii Plastid Chromosome

SDR No.Size (bp)Sequence aSimilarity bOccurrence cG+C (%)Pyrimidines (%)
SDR126CTGCCTCCTTCCCCTTCCCATTCGGG90486580
SDR227ATATAAATATTGGGCAAGTAAACTTAG90282637
SDR333ATAAACTTTAGTTGCCCGAAGGGGTTTACATAC90563948
SDR425AGGACAAATTTATTTATTGTGGTAC90192848
SDR6.131GGACGTC AGTGGCAGTGGTACCGCCACTGCC90376848
SDR6.223GTGGCAGTGGTACCGCCACTGCC90687052
SDR733TCCACTAAAATTTATTTGCCGAAGGGGACGTCC90514551
SDR832TAGGCAGTTGGCAGGCAACTGCACTGACGTCC90345946
SDR9.124CTGCCAACTGCCGATATTTATATA100363758
SDR9.2 d24CTGCCAACTGCCGATATTTATATA90513758
  • a Underlined bases are AatII (GACGTC) and KpnI (GGTACC) restriction sites.

  • b Percentage divergence among those sequences that share similarity based on BLAST analyses.

  • c Number of copies in the full genome sequence.

  • d If stringency is decreased to 90%, allowing three mismatches, an additional 15 copies of this repeat are detected.