Table 1.

A Sample of the SAIL Table

GeneaInsertion SitebGene LengthcInsertion Linee ValueForward PrimerdReverse Primerd
At5g2703058246350SAIL_184E070GGAGACACGCGGGTTCAGTGATTCATGTACCAAACCTTACAA
At5g2703058156350SAIL_184E08e-137GGAGACACGCGGGTTCAGTCCAATTTCTCATGTTTCAGAAGT
At5g27030−1196350SAIL_583G070CGAATCCGCCACTCTATCTCCAAAATTCAGCCTCTCACAACA
At5g2703059536350SAIL_790B011.00E-30CATCTCTGACCTGGCATGTATGGGTGAGCCGCCACAACAA
At5g27050−756362SAIL_1244D060CTTCACCAGCAGCGTTAACCTGGTTTGTTTGGGCGAAGAAG
At5g27050−915362SAIL_399G120ACTTGACAAGCCCATGTATTTCGAATGAAAGCAAGCCCCAAATA
At5g27050−1346362SAIL_399H121.00E-08TGCAAATATGACTCCACTTGATAGGTTGCAAGGCAACCCTAAAT
At5g27050−547362SAIL_759C031.00E-98CTCGGAGAGCTTCCAAGGAAGCATGTTACATTTGGCTTTGTAT
At5g27070−159863SAIL_281C05e-153CTTGACACGTGCCACAATCTTGAAGAAGACAGGGACGATTTC
At5g27080−6441478SAIL_211B114.00E-52GTCGCACAGAGTCGAAAGCTTGAAAAACCCCAACGGTTAGAT
At5g27080−5771478SAIL_247D042.00E-14TCGTGGTCTTTTTTGCATTGGATCCTCTATGATATCAAACATACAA
At5g27080−5731478SAIL_247D043.00E-37TCGTGGTCTTTTTTGCATTGGATCCTCTATGATATCAAACATACAA
At5g27080−8751478SAIL_361H040CGTGGAGGATCTGCTTACGTCGATATGGAAATCGATCGAATTT
At5g27080−4491478SAIL_831F08e-127CAGTGAAAGTTGAGAGGGTTATAGCTGAGAGGGAAGCGAATGAT
At5g27090−120563SAIL_211B114.00E-52GTCGCACAGAGTCGAAAGCTTGAAAAACCCCAACGGTTAGAT
At5g27090−187563SAIL_247D042.00E-14TCGTGGTCTTTTTTGCATTGGATCCTCTATGATATCAAACATACAA
At5g27090−191563SAIL_247D043.00E-37TCGTGGTCTTTTTTGCATTGGATCCTCTATGATATCAAACATACAA
At5g27090111563SAIL_361H040CGTGGAGGATCTGCTTACGTCGATATGGAAATCGATCGAATTT
At5g27090−315563SAIL_831F08e-127CAGTGAAAGTTGAGAGGGTTATAGCTGAGAGGGAAGCGAATGAT
At5g27100593151SAIL_1290bB10e-161CACGTATCTCAGTGCATGCAATGAGACGAAGTCTCCTCCTTT
At5g27100−1153151SAIL_439B090GAGTAAGCCGTTCCGATATCAAAACCGGGCTGCAGTTGGAT
At5g27100−10563151SAIL_504C110AGCATGACCACAAGCTGACAAGTGAACTGTTCCTTGATTGATC
At5g27100−10573151SAIL_504C110AGCATGACCACAAGCTGACAAGTGAACTGTTCCTTGATTGATC
At5g27100−5413151SAIL_856D032.00E-13CATTGACCGGATTCCATGTGAACCTGATGGGGTTACTCTTCT
At5g2711022212075SAIL_439B090GAGTAAGCCGTTCCGATATCAAAACCGGGCTGCAGTTGGAT
At5g2711012802075SAIL_504C110AGCATGACCACAAGCTGACAAGTGAACTGTTCCTTGATTGATC
  • a Arabidopsis Gene Index numbers.

  • b Positive values indicate distance in bp downstream from the first coding base, and negative values indicate distance upstream.

  • c Length of genomic sequence from the first coding base to 150 bp downstream of the predicted stop site.

  • d Forward and reverse primers that flank the predicted insertion that can be used for insert confirmation.