Table 3.

Primer Sequences Used

Primer
 Name5′ to 3′ Sequence
dBR2GCNGARATGGARACNATHGGNAARATHAARCA
dBR5GCCATNCCRAARTCNSWNACNCKNGCMTC
DW52TTCTTTTGAAATTTTGAGGTGCATC
DW53CTCCCATATCTGGCTCTTTG
Oligo-(dT)GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTT
TACT1ATTGCTCTTGACTATGAACAGG
TACT2CTTGCTCATCCTATCAGCAATACC
4-9CAAGCTGAATTGGCCTGCAAG
4-10CAAGACATTACTTGATTTCATGTCC
5-1TGGATGGGAACTAGTGGTACATAC
TBR 20GTCAATCTCTCCAAGCAATGTAAGACTG
TBR 27CTGCTGAATTGGGTAATTGCCAGAG
TBR 29TCCTCAACAACTTGGAGGCTTGAAG
TBR 31TTGGAGACTTTGGATATGAGTTC
TBR 32GGATCTTTGCAAATCCCAGATGG
TBR 35AGATCTATGGAGTCTAAAGTAACC
TBR 41CATCAAGAGCTCAAGCTATAGATTCAAG
TBR 42CCCCAGAGATTAGAGTGTGTTCTC