Table 2.

SSLP Markers Used for Mapping the ITB1 Gene

SSLP Length
NameSequence (5′→3′)ColRLDLerWsLocation (BAC)
S1 FTTTGGATGGATTTGTGCGTG81816981T14G11
S1 RCGATGAGGTCAATCCTAAAGATCAG
S2 FGACATTGGCTCTTTCTACGATTTC129167177187F13K3
S2 RTGCGTGCATGTAATATCTTATCAG
S3 FCCACGGCCAGGTAATGTTTTAA78789478F16M14
S3 RCAGTGTAGTGATCTTTATAATGTGATGA
S4 FTAGAGATTGGACCCACAAGAGA178178178135T7F6
S4 RCGCTTCGACTCACAAATATTTTATG
S5 FCGCTTCGACTCACAAATATTTTATG150150120120F12l6
S5 RTTGAAAGATCACGCCGGCGA
  • Ler, Landsberg erecta; Ws, Wassilewskija.