Table 1.

Primers Used for RT-PCR Analysis of RopGEF Expression in Mature Arabidopsis Pollen

GeneForward Primer (5′/3′)Reverse Primer (5′/3′)
RopGEF1GAAGATCTATGGGGAGCTTATCTTCTCGGGTACCTTAATCTCTTTCCGGCGT
RopGEF2GGATCCCGATGGAGAATTTGCCAAATCACGGGAATTCTCATTCTTCTCCTCTCAT
RopGEF3GAATTCATCCCTAGATGTCAGAATCTTCACTACCTCTCATGG
RopGEF4ATGGAGAGTTCTTCGAATTCCGACCAATCTCTACCACCACCACCCG
RopGEF5GGATCCCGATGGAGAATTTAGTGAAGAGCGGAATTCTTAAGAGACAGTGTACTT
RopGEF6ATGGAGGATAATAGCTGTATCGGGCCAATTATCTCCGGGGTTGA
RopGEF7GGATCCCGATGGATGGTTCGTCGGAAGGAATTCGTCAAATCCCAGGATCAA
RopGEF8GGATCCATGGTTGCAGCGTTGGAAGGTACCCTGCAGTTAATGCCTATCTTTGGG
RopGEF9GGATCCATGGTTCCATCGTTGGAAGGTACCTCAATGCCTATCTTTAGG
RopGEF10ATGTTCGATGGTCGGAACTCTTCAGTGTCTGTCACTAGGGC
RopGEF11ATGGAGCAAGAACAAGAGACTGGTACCTCAGGAGTATCTTGCGGT
RopGEF12GAAGATCTATGGTTCGTGCTTCGGAAGGAATTCTCAATGCCGTGCCGTTGG
RopGEF13ATGGTGAAAGCGAGTGAGAAAGAAGGAATGTTGGAGACAAGATC
RopGEF14GGATCCCGATGATGCTGATGAGAAGACGATATCTCAAGGAGAAGTATCAGAAG