Table 4.

Some Abundant CHS siRNA Sequences Derived from the Yellow Seed Coats with Dominant Alleles from the Williams (ii) or Richland (I) Cultivars and Their Alignments to CHS Genes

CHS siRNA SequenceWilliams CountsRichland CountsCHS StrandCHS Gene Alignmentsa
CAACTTGTGGAATTGGGTCAG91311007*8*
AAGCATTGTTTGGAGATGGAG825345+1234567*8*9
TTTGTATGAGCTTGTTTGGAC803799+7*8*
CACGGAATGTGACTGCAGTGA7233253457*8*9
TCAGAACCAACAATGACTGCA5516297*8*
TCTCAACTTGTGGAATTGGGT5346067*8*
TTACCCACTTGATCTTCTGCA54594+7*8*
TCAAAGAACATTGATAAGGCA529307+7*8
ACGGAATGTGACTGCAGTGAT4712793457*8*9
TCAAAGAACATTGACAAGGCA466331+78*
CACCTTCGTTGGATGCAAGGCA45116+1*23*4*5*69*
CCTTCGTTGGATGCAAGGCAA3258+1*23*4*5*69*
CGCGGAATGTGACTGCGGTGA29812313*4*5*789*
  • Data are from Supplemental Data Set 2 online.

  • a Asterisk represents 100% match to exon 2 of the indicated CHS gene, and no asterisk denotes a single base mismatch of the CHS siRNA sequence to the indicated CHS gene. Blanks indicate more than one mismatch; + strand direction is the coding direction for all CHS genes.